Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 7 BROMO 2 3 4 5 TETRAHYDRO 1H BENZO E 1 4 DIAZEPINE 2 CARBOXYLIC ACID METHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... each of the libraries was diluted 4-fold prior to running on a 1% Agarose E-gel (Life Technologies, #G402001, Carlsbad, CA) with a E-Gel 1-Kb Plus DNA Ladder (Life Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... The filtered lysate was diluted 1:2 in purification buffer UA (8 M Urea, 50 mM sodium acetate [Acros Organics, Carlsbad, CA], pH 4). The protein was then purified using a cation exchange HiPrep SP HP 16/10 (Cytiva ...
-
bioRxiv - Cell Biology 2021Quote: ... permeabilized with 0.1% Triton X-100 in PBS for 10 min and blocked with 2% BSA solution in PBS for 1 h followed by overnight incubation at 4°C with primary antibodies diluted in 2% BSA blocking solution: mouse monoclonal [1F7G5] anti-CKS2 (1:100 dilution; Thermo Fisher Scientific; 37-0300), rabbit polyclonal anti-P63 (p63α ...
-
bioRxiv - Biophysics 2021Quote: ... Infrared exposure levels for INS were selected based on their ability to elicit dynamic calcium responses (>2% increase, dF/F) in NG108 cells loaded with a calcium dye (Fluo-4-AM at 1 μM, ThermoFisher, St. Louis, MO, USA). Radiant exposures for no stimulation ...
-
bioRxiv - Neuroscience 2022Quote: ... The sections were then incubated for 2 h at 4℃ with Alexa fluor 488-conjugated secondary antibody (1:200, Invitrogen, #A21206, Carlsbad, CA, USA) or DAPI (1:30000 ...
-
bioRxiv - Molecular Biology 2023Quote: ... CKY2038 was grown to mid-log (1-2×107 cells/mL) in SC liquid media and added to the ConA treated perfusion chamber gasket (ThermoFisher, 4 chamber: 19 × 6mm) for treatment at indicated conditions (SC+1% DMSO ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Microbiology 2023Quote: ... Tissues were maintained in E-medium (3:1 ratio of DMEM:F12 (Thermofisher, 21765029) medium supplemented with 10 % FBS and 1 % PS ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Copies of SARS-CoV-2 E gene were measured by qRT-PCR TaqMan Fast Virus 1-step assay (Thermo Fisher). SARS-CoV-2 specific primers and probes from the 2019-nCoV RUO Assay kit (Integrated DNA Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Immunology 2022Quote: ... 700 μg of protein were mixed and rotated with 0.5 μg of STING antibody for 3 h at 4 °C after which 25 μL of Dynabeads Protein G (Invitrogen, 10004D) were added to each sample and rotated for an additional hour ...
-
bioRxiv - Cell Biology 2023Quote: ... maintained at 37° C and 5% CO2 and passaged every 3-4 days using trypsin-EDTA 0.05% (Life Technologies, Paisley, UK) to detach the cells ...
-
bioRxiv - Physiology 2024Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Cell Biology 2019Quote: ... or caspases 3/7 (Caspase-3/7 Green ReadyProbes™ reagent with a DEVD sequence, Molecular Probes).
-
bioRxiv - Immunology 2023Quote: ... The caspase-3/7 activity assay contained CellEvent Caspase- 3/7 Green Detection Reagent (Thermo Fisher, C10723) at a final ...
-
bioRxiv - Bioengineering 2022Quote: RPTEC organoids were imaged every 2-3 days with a EVOS FL 2 Auto microscope (Thermo Fisher) with a 4x objective ...
-
bioRxiv - Cancer Biology 2023Quote: ... The lungs were inflated with 1-3 ml 2% UltraPure Low Melting Point Agarose (Invitrogen). Lungs and livers were fixed overnight at 4°C on a shaker ...
-
bioRxiv - Molecular Biology 2021Quote: ... the input aliquot (100 µl) was mixed with equal volume of 2× protein sample buffer (2× NuPAGE LDS buffer [Life Technologies], 100 mM DTT, 4% [w/v] SDS) and the IP with 100μl 1 x protein sample buffer followed by incubation for 10 min at 75 °C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Cell Biology 2022Quote: ... VOs we’re fixed for 1 hour in 4% paraformaldehyde solution (Thermo Fisher Scientific, 7732-18-5) in PBS and for 2 hours in 2.5% glutaraldehyde in PHEM buffer (TAAB ...
-
bioRxiv - Microbiology 2022Quote: ... Roughly 1/3 of the plate (2-3 loopfuls) were added to 400 µl 1x Tris-Ethylenediaminetetraacetic acid (EDTA) pH 7.5 (Thermo Scientific, Waltham, USA) and heated at 80 ºC for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: Sample digests were acidified with formic acid to a pH of 2-3 prior to desalting using C18 solid phase extraction plates (SOLA, Thermo Fisher Scientific). Desalted peptides were dried in a vacuum-centrifuged and reconstituted in 0.1% formic acid for LC-MS analysis.
-
bioRxiv - Biophysics 2020Quote: Recombinant GST-tagged PH-domain of PLCd detecting the membrane lipid PI(4,5)P2 was produced and conjugated to of amine-reactive Alexa Fluor 647 carboxylic acid succinimidylester (Invitrogen) as previously described49 ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Biochemistry 2021Quote: RNA was isolated from the aqueous phase of homogenized spleens mixed with 1-bromo-3-chloropropane and purified with the PureLink RNA kit (Invitrogen) separately ...
-
bioRxiv - Biochemistry 2022Quote: ... 1% nonessential amino acids (1140050) and 50μM 2-mercaptoethanol (31350-010) (all Thermo Fisher Scientific unless specified), 1,000 U/ml LIF (ESGRO ESG1107 ...
-
bioRxiv - Systems Biology 2023Quote: ... 0.1 mM CaCl2 and either 10% Luria Broth (Figs 1&2) or MEM amino acids (from Gibco) (Figs 3–5) ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... freshly mitochondria isolated from pupae were resuspended in respiration buffer (0.5 mg/ml) containing Tetramethylrhodamine methyl ester perchlorate (0.5 μM) (Thermo Fisher). The excitation spectra were scanned from 520 nm to 580 nm using 590 nm emission wavelengths ...
-
bioRxiv - Biochemistry 2021Quote: ... The RBD/Legobody complex at 2.5mg/ml were incubated with MS(PEG)12 methyl-PEG-NHS-ester (Thermo Fisher) at a 1:25∼28 molar ratio for 2 hrs on ice ...
-
bioRxiv - Plant Biology 2020Quote: ... cinerea germlings exposed to different concentrations NCR044.1 was measured every 30 min for 2 h using the ROS indicator dye 2′,7′-dichlorodihydrofluorescein diacetate (H2DCF-DA, Invitrogen, Carlsbad, CA). ROS levels were quantified by measuring the fluorescence in a SpectraMax® M3 spectrophotometer microplate reader (exc ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with 0.5 µM Lipi-Deep Red neutral lipid stain (Dojindo #LD04-10) for 2 hr and 5 µg/mL Hoeschst 33342 nucleic acid stain (Invitrogen #H3570) for 30 min at 37°C ...
-
bioRxiv - Developmental Biology 2019Quote: The compound 5-(and-6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA, Image-iT LIVE Green Reactive Oxygen Species Detection Kit, Molecular Probes; Invitrogen, I36007) was used to visualise the in vivo production of ROS ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Synthetic Biology 2021Quote: ... Annealing efficiency was confirmed by visualizing the dsDNA on a 4% EX Agarose E-Gel (Thermo Fisher Scientific Inc. ...
-
bioRxiv - Cell Biology 2020Quote: Fluorescent microtubules were polymerized from 4 mg/ml porcine tubulin (80% unlabeled and 20% Alexa Fluor 647 NHS ester-labeled; Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... which was followed by an overnight incubation at 4°C with N-hydroxysuccinimide ester derivatives of AF647 (Thermo Fisher Scientific) present in two-fold molar excess.
-
bioRxiv - Biochemistry 2020Quote: ... Cells were mounted on ProLong Gold with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA, USA) and imaged using a Delta-Vision II microscope system with an Olympus IX-71 inverted microscope using a 100x objective A ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2 x 105 – 4 x 105 mESCs were cultured in 60mm Petri dishes in DFNB medium (Neurobasal medium/Gibco, DMEM F12 1:1/Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... Fluorescent indicators (fluo-4 AM, fura-2 AM, fura-FF AM) were purchased from Molecular Probes (Thermo Fisher Scientific). NMDA was from Merck Millipore ...
-
bioRxiv - Molecular Biology 2020Quote: ... were resolved on precast NuPAGE 4-12% Bis-Tris midi 12+2-well protein gels (cat. no. WG1401BOX, Invitrogen) at 200 V for 40 min in NuPAGE 2-(N-morpholino)ethanesulfonic acid (MES ...
-
bioRxiv - Molecular Biology 2020Quote: ... Slides were mounted in ProLong™ Gold Antifade Mountant containing 4’,6’-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). Images were acquired at 100x magnification using a Nikon Eclipse Ti fluorescence microscope fitted with a Hamamatsu C11440 digital camera ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole and were embedded with ProLong Gold mounting medium (Life Technologies). ImageJ/Fiji software (National Institutes of Health ...
-
bioRxiv - Neuroscience 2020Quote: Human sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) and coverslips were mounted using Prolong Gold (Invitrogen) for imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were mounted in ProLong Gold antifade reagent supplemented with 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes). Conventional immunocytochemical staining was done to quantify the activated PAK1 and actin in oAβ and IPA-3 treated cells using phospho-PAK1 (Thr423)/PAK2 (Thr402 ...