Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 6 Boc 1 oxa 6 azaspiro 3.3 heptan 3 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2022Quote: ... wash buffers were removed and replaced with a ~7.6 pH nigericin buffer standard (25 mM HEPES, 80 mM KCl, 1 mM MgCl2) supplemented with 10 μM nigericin (Invitrogen, N1495). Cells were incubated at 37°C for 10 min ...
-
bioRxiv - Genetics 2022Quote: ... ~1 × 105 hTSC were seeded onto 6 well plates coated with either 5–10 μg/mL collagen IV (10376931, Fisher Scientific) or 0.5 μg/mL iMatrix 511 (NP892-011 ...
-
bioRxiv - Microbiology 2022Quote: ... DF-1 cells were seeded on 6-well plates and transfected with two μg of expression vector using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2023Quote: ... RNA products were then excised from a 6% (vol vol−1) PAA-7M urea gel by comparison to a LowRange RNA ladder (ThermoFisher Scientific) and eluted overnight in elution buffer (0.1 M NaOAc ...
-
bioRxiv - Neuroscience 2023Quote: ... in 6-well tissue culture plates containing 1 ml pre-warmed culture medium (42% MEM, 25% Basal Medium Eagle; Thermo Scientific), 25% Normal Horse Serum ...
-
bioRxiv - Physiology 2023Quote: ... Each cDNA sample was amplified with messenger RNA (mRNA) specific TaqMan Gene Expression Assays (IL-6, Mm00446190_m1; MCP-1, Mm00441242_m1; GAPDH, Mm99999915_g1; Thermo Fisher Scientific, Waltham, MA) on a CFX-96 real-time polymerase chain reaction (PCR ...
-
bioRxiv - Neuroscience 2023Quote: ... 500,000 cells were plated in 6-well dishes and 1 μg of DNA was transfected when cells reached 75-85% confluency with Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... PBS was replaced with a 1:6 (weight: volume) solution of 0.5 M acetic acid (984303; Thermo Fisher, Waltham, MA, USA) with 1 mg/ml pepsin (20343 ...
-
bioRxiv - Biophysics 2023Quote: ... 400 μg of calmodulin and myosin-5 expression vectors (at a 1:6 ratio) were mixed with 15 ml FreeStyle 293 media (Thermo Fisher) and 1.2 ml of PEI (Polysciences ...
-
bioRxiv - Bioengineering 2023Quote: ... to each well we add 200 μL of 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, Cat. No. D3571) solution in DI water ...
-
bioRxiv - Genetics 2023Quote: ... Cultures were passaged every 5-6 days as small clumps by dissociation with a buffer containing 1 mg per ml Collagenase IV (ThermoFisher Scientific), 0.025% Trypsin (ThermoFisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... Bacmid DNA containing the construct of interest was transfected into 2mL of Sf9 cells at a density of 1×106 cells/mL on a 6-well plate using ExpiFectamine Sf Transfection Reagent (Life Technologies) and following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... followed by 40 cycles of 95°C for 15 s and 60°C for 1 min (Applied Biosystems QuantStudio 6 Flex). For testing of U7 snRNA level in U7 KD cells ...
-
bioRxiv - Immunology 2023Quote: ... and 1 × 10^6 were processed using Click-iT EdU Pacific Blue Flow Cytometry Assay Kit (Thermo Fisher Scientific Cat. #C10418). The other 1 × 10^6 were subjected to anti-CD3 crosslinking and pERK staining as described below ...
-
bioRxiv - Bioengineering 2023Quote: ... Sigma-Aldrich 7722-84-1) and then slowly injecting 0.03 % w/v sodium dithionite (ACROS Organics 7775-14-6, in PBS) using a syringe pump (10 µL min−1 ...
-
bioRxiv - Systems Biology 2023Quote: ... the cell nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Thermo Fisher Scientific, Waltham, MA, USA) in PBS for 15 minutes at room temperature ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by washing and addition of secondary antibodies and 4′,6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific, 62248) for 30 mins ...
-
bioRxiv - Developmental Biology 2024Quote: Total protein was extracted from 1-2 wells of a 6-well plate using RIPA lysis buffer with protease inhibitor (ThermoFisher Scientific). Protein concentration was measured using Pierce BCA kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Tumors were engrafted by inoculating 1×106 Nalm-6 cells expressing firefly luciferase and GFP intravenously in 100 μL of PBS (Gibco, USA). Mice were randomly assigned to 2 experimental groups and 1 control group ...
-
bioRxiv - Neuroscience 2023Quote: ... into low passage HEK-293T cells plated at 1×106 cells/well of a poly-D-lysine-coated 6-well plate using Lipofectamine 3000 (Life Technologies). The next day ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.7 mL Buffer 2 (1 M sorbitol, 50 mM MES, pH 6, 5 mM MgCl2) plus protease inhibitors (Thermo Scientific A32955) was added ...
-
bioRxiv - Microbiology 2023Quote: ... sections were counterstained with 1 µg/ml of 4’,6-diamidino-2-phenylindole (DAPI, #D1306, Thermo Fisher Scientific, Waltham, MA, USA) then ...
-
bioRxiv - Cell Biology 2023Quote: ... cell pellets corresponding to two wells of a 6-well plate (double-well pellet with same treatment conditions) were lysed in 1% (v/v) TritonX-100 buffer (Fisher Scientific) in DPBS supplemented with 1% (v/v ...
-
bioRxiv - Biochemistry 2024Quote: ... 0.12 x 106 COS-7 cells were seeded into each well of a 6 well plate and transfected with 1 μg total DNA using Lipofectamine p3000 (ThermoFisher Scientific). Cells were rinsed in PBS 5 hours post transfection ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were reversed transfected with 1 pmol (96-well) or 25 pmol (6-well) siRNA using Lipofectamine RNAiMAX (Life Technologies, 13778150) and Opti-MEM (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2024Quote: ... 25 μg of peptides per condition were labelled with isobaric tags by incubation for 1 hour at RT (TMT 6-plex and 10-plex, Thermo Fisher Scientific ...
-
The RNA-binding protein RbpB is a central regulator of polysaccharide utilization in gut BacteroidesbioRxiv - Microbiology 2023Quote: ... and the RNA product purified from a 6% (vol vol-1) PAA-7M urea gel using a LowRange RNA ladder (ThermoFisher Scientific) for precise sizing ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cancer Biology 2022Quote: Signal determination and quantitation was performed using TraceFinder™ Software Version 3.3 (Thermo Fisher) or using El-Maven Software Version 0.12.0 (https://elucidata.io/el-maven/).
-
bioRxiv - Synthetic Biology 2020Quote: ... 3.3 nM of 5-chloromethylfluoresecein di-beta-D-galactopyranoside (CMFDG) (Invitrogen, Waltham, MA, USA) was added to the reaction solution ...
-
bioRxiv - Immunology 2023Quote: ... XIC generation and signal quantitation was performed using TraceFinder V 3.3 (Thermo Fisher Scientific) integrating peaks which corresponded to the calculated monoisotopic metabolite masses (MIM +/− H+ ± 3 mMU).
-
bioRxiv - Physiology 2023Quote: ... Targeted data processing of known metabolites was determined using TraceFinder (v 3.3, Thermo Scientific) software and compound identities are confirmed using reference standards and reference samples included in each analysis queue ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 EV samples (2 per cell type, 1 ZIKV and 1 control each) were fixed in 2% paraformaldehyde (PFA; Fisher Scientific, Cat #50-980-487) and processed as cited 59 ...
-
bioRxiv - Plant Biology 2021Quote: ... two SlP4H3 OEX lines (#1, #2) and three SlP4H3 RNAi lines (#1, #6 and #7) by using the TRI reagent (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcription of approximately 1 μg of total RNA was performed with Superscript II® Reverse Transcriptase (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Physiology 2019Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in PBS at 5 mg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Neuroscience 2024Quote: ... 1:100 Culture One (ThermoFisher #A33202-01). Depending on the length of the experiment ...
-
bioRxiv - Cancer Biology 2021Quote: ... Plates were run on a QuantStudio 6 Flex Real-Time PCR System (Thermo Fisher), and data were analyzed using the comparative CT method to generate expression fold-change values ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cell nuclei were counterstained with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific) and cells were mounted using Prolong Gold Antifade reagent (Invitrogen) ...
-
bioRxiv - Cell Biology 2020Quote: ... HEK293T cells were transiently transfected in 6-well plates with Lipofectamine 2000 (Life Technologies), as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Before mounting cells were stained with DAPI (4’,6-diamidino-2-phenylindole) dye (ThermoFisher) and mounted with Dako mounting medium and imaged by confocal microscopy and previously described 19.
-
bioRxiv - Cell Biology 2020Quote: ... 6-ketocholestanol or phloretin cells were incubated with di-8-ANEPPS (Thermo Fisher, D3167) at a final concentration of 2 μM on ice for 20 minutes (33 ...
-
bioRxiv - Cell Biology 2020Quote: ... differentiation was initiated on day -6 by adding RPMI/B27 minus insulin (Gibco, USA) supplemented with 1 μM CHIR 98014 (Selleckchem ...
-
bioRxiv - Microbiology 2021Quote: ... loaded on to a Novex Pre-cast 6% TBE-Urea (8M) polyacrylamide gel (Thermofisher) in 1X TBE and run for 45-60 min ...