Labshake search
Citations for Thermo Fisher :
1751 - 1800 of 10000+ citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then rinsed in PBS 6 times for 5 minutes each followed by incubation with goat anti-rabbit IgG Alexa Fluor 594 (#A32740, ThermoFisher Scientific, Waltham, MA) and goat anti-mouse IgG Alexa Fluor 488 (#A11008 ...
-
bioRxiv - Microbiology 2021Quote: Keratinocytes were seeded at a density of 5×105 cells/well in a 6-well tissue culture plate (Nunc; Thermo Fisher Scientific, Singapore) and grown for 3 days at 37°C in a 5% CO2 humidified atmosphere ...
-
bioRxiv - Developmental Biology 2022Quote: ... 95 °C for 5 seconds and 60 °C for 20 seconds in a QuantStudio 6 Flex Real-Time PCR machine (Thermo Fisher Scientific, USA). The detectors used were FAM-BHQ1 and HEX- BHQ1 ...
-
bioRxiv - Immunology 2024Quote: ... followed by 40 cycles of denaturation at 95 °C for 5 sec and extension at 58 °C for 34 sec in the QuantStudio 6 system (Applied Biosystems Co., USA). At the end of PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... Intact 12 day-old seedlings were transferred in 8 mL of 1% liquid MS media (as above) in 6-well plates (Nunc, cat. No. 140675) and acclimated for 2 days with mild agitation (130 rpm) ...
-
bioRxiv - Microbiology 2023Quote: Isolates from wastewater and isolates provided from collaborators (8 animal/food, 6 environment, 1 human skin, 137 UTI) were grown in tryptic soy broth (TSB; Thermo Scientific; cat. CM0129B) for 24 – 48 hours at 37°C to an OD600 of ∼1 ...
-
bioRxiv - Immunology 2023Quote: ... 7-Aminoactinomycin D (7-AAD) (Invitrogen) at 1:400 was used as a marker for dead cells ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The pbf1 gene of johansen Standard was amplified with the primer pair psbNRO_F 5’-AGCATTGGGAGGCTCATTAC-3’ and psbNRO_R 5’-GGAAACAGCAACCCTAGTCG-3’ and cloned into to pCRTM2.1-TOPO® (Invitrogen). The vector was linearized with HindIII and in vitro transcription was performed according to the suppliers’ protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... the cultures were washed with HBSS and loaded in 5 μM Fura2-AM (108964-32-5; Life Technologies) in HBSS for 45 min ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5 μg/mL plasmocin and 10 μg/mL of STI with 5 μM of CellTracker Red CMTPX (Invitrogen) for 15-20 minutes at 37°C with 0% CO2 incubator ...
-
bioRxiv - Microbiology 2020Quote: ... RdRp_rev 5’-CAAATGTTAAAAACACTATTAGCATA-3’ RdRp_probe 5’-FAM-CAGGTGGAACCTCATCAGGAGATGC-TAMRA-3’) and/or TaqMan gene expression assays (Applied Biosystems) for ACTB (Hs99999903_m1) ...
-
bioRxiv - Developmental Biology 2022Quote: RNA was extracted from 5 pooled larvae aged 5 dpf using the PicoPure RNA Isolation Kit (Applied Biosystems). After quality control ...
-
Structure of the Human Signal Peptidase Complex Reveals the Determinants for Signal Peptide CleavagebioRxiv - Biochemistry 2020Quote: ... Peptides were first trapped on the trapping cartridge (PepMap100 C18, 5 μm, 5 mm × 300 μm; Thermo Scientific) prior to separation on an analytical column (Poroshell EC-C18 ...
-
bioRxiv - Biochemistry 2021Quote: ... equipped with two PepMapTM C18 μ-precolumn (0.3 mm × 5 mm, 5 µm, 300 Å Thermo Fisher Scientific) and an AcclaimTM PepMapTM analytical column (75 μm × 250 mm ...
-
bioRxiv - Immunology 2022Quote: ... and their corresponding FAM-labelled MGB probes (εGLT: 5′-AGGCACCAAATG-3′ and γ1GLT: 5 ′-CTCAGCCAGGACCAAG-3′) (Applied Biosystems) were designed in house ...
-
bioRxiv - Neuroscience 2023Quote: ... 5’- CCACCCTCCAGCCAATC-3’ and FAM/ZEN-labeled probe 5’-ACAGGGCAACCATTGGCTCG-3’ with Taqman Gene Expression Master Mix (ThermoFisher).
-
bioRxiv - Molecular Biology 2022Quote: ... Tryptic peptides were loaded onto a trap column (Pepmap 100, 5 μM, 5 x 0.3 mm, ThermoFisher Scientific) at a flow rate of 10 uL/min using 2% ACN and 0.05% TFA as loading buffer ...
-
bioRxiv - Biophysics 2023Quote: ... The grids were blotted at -5 power for 5 s in FEI Vitrobot Mark IV (Thermo Fisher Scientific) at 4°C and 100% humidity and immediately frozen in liquid ethane ...
-
bioRxiv - Microbiology 2023Quote: The embB region containing codon 406 was amplified using PCR primers F1 5’-TGATATTCGGCTTCCTGCTC-3’ and R1 5’-TGCACACCCAGTGTGAATG-3’ designed using Primer3 (23) (version 0.4.0) and acquired from ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... Peptides were loaded onto a trap column (PepMap 100 C18, 5 μm, 5 × 0.3 mm, Thermo Fisher Scientific) at a flow rate of 10 μL/min using 0.1% TFA as loading buffer ...
-
bioRxiv - Biochemistry 2023Quote: ... The aqueous phase was mixed with 5 µL of 5 mg/mL linear acrylamide co-precipitant (Invitrogen, AM9520) and 1000 µL of ethanol for precipitation ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... siRNA targeting topoisomerase 2beta (5’CGAUUAAGUUAUUACGGUUtt 3’, s106; 5’ GAGUGUACACUGAUAUUAAtt 3’, s108; both purchased at Ambion/ThermoFIsher Scientific), TDP2 (5’ GUGGUGCAGUUCAAGAUCAtt 3’ ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Viral 5’ terminal positions were determined using the 5’RACE System for Rapid Amplification of cDNA Ends (Invitrogen). To obtain 3’ ends ...
-
bioRxiv - Microbiology 2024Quote: ... pRS1841 was PCR-amplified using primers sdm_GlnA_R66A_for (5’ATTGAAGAAAGCGATATGAAACTGGCGC3’) and sdm_GlnA_R66A_rev (5’CGCGGTAAAGCCCTGAATGCTGCTACC3’) by Phusion High-Fidelity polymerase (Thermo Fisher Scientific, Waltham, Massachusetts) followed by religation resulting in plasmid pRS1951 ...
-
bioRxiv - Neuroscience 2024Quote: ... After 4 times 5-minute washes in PBS with 0.5 % Tween® 20 (Fisher Scientific #9005-64-5), each slide was again dried around tissue slices and PAP pen was re-applied ...
-
bioRxiv - Cancer Biology 2024Quote: ... that consisted of an µ-precolumn (C18 PepMap100, 5 µm, 100 Å, 5 mm × 300 µm; Thermo Scientific), and an analytical column (120 EC-C18 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7% glacial acetic acid in water for 15 min and stained with GelCode Blue Stain (Thermo Fisher Scientific). For in-gel digestion ...
-
bioRxiv - Cell Biology 2020Quote: ... Enteroids were passaged every 5 to 7 days by incubating in 0.25% trypsin 0.5 mM phosphate buffered saline-ethylenediaminetetraacetic acid (PBS-EDTA, Gibco) solution for 3 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Lysosomal ExRai AMPKAR was made by inserting PCR-amplified LAMP149 generated using primers 7-8 into HindIII (ThermoFisher FD0504)/BamHI-digested ExRai AMPKAR backbone ...
-
bioRxiv - Microbiology 2019Quote: Huh-7 and C6/36 cells were grown in 8 well chambers (LAB-TEK®, Nalgene Nunc International, USA) for 24h ...
-
bioRxiv - Immunology 2021Quote: ... samples were centrifuged 1000 x g for 5 minutes and resuspended in PBS with 5mM Ethylenediaminetetraacetic acid (EDTA) (Fisher Scientific, Cat. #50-103-5745) and 1% v/v FBS ...
-
bioRxiv - Immunology 2019Quote: ... Bacteria were labeled with 5 μM Syto™ 9 Green Fluorescent Nucleic Acid Stain or 500 nM pHrodo Red SE (ThermoFisher Scientific, Waltham, MA) and washed 3-5 times with PBS prior to infection ...
-
bioRxiv - Microbiology 2019Quote: ... pellets were thawed at 37°C and then subjected to a single round of sonication on ice (Sonic Dismembranator 60, Fisher Scientific, setting 8, 5 seconds). Lysates were clarified by centrifugation at 20,000 rcf for 60 minutes at 4°C ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge, Thermo Fisher Scientific, Darmstadt, Germany). The fluorescence intensity of the supernatant was measured measured (485 nm excitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5 ng/mL EGF (ThermoFisher Scientific, 17005042), 50 μg/mL bovine pituitary extract (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL EGF (Invitrogen, 10450-013), 7.5 μg/mL bovine pituitary extract (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... supplemented with 5% FBS (ThermoFischer/Invitrogen 10270098) and 20 nM of 20-hydroxyecdysone (Sigma H5142)(Dye et al. ...
-
bioRxiv - Genetics 2020Quote: ... 5% CO2 and cultured in DMEM (Gibco) with 10% Fetal Bovine Serum (VWR Life Science Seradigm ...
-
bioRxiv - Microbiology 2019Quote: ... (Corning)] containing 5% fetal bovine serum (FBS) (Gibco) (Arnold et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 5 μL SybrGreen (Applied Biosystems 4309155).
-
bioRxiv - Developmental Biology 2021Quote: ... and 5% fetal bovine serum (Thermo Fisher).
-
bioRxiv - Genomics 2020Quote: ... 5 mM EDTA (Ambion, Cat. No. AM9260G), 0.4% Triton X-100 (Sigma ...
-
bioRxiv - Cancer Biology 2022Quote: ... Glutamax (5 ml, Gibco, cat no. 35050061), Penicillin/Streptomycin (10,000 U/ml ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5% sodium pyruvate solution 100 mM (Thermofisher). Undifferentiated cells were cultured at 33 °C in the presence of 10U/mL murine IFN-gamma (R&D systems) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5 µl 10X DreamTaq Buffer (ThermoFisher #EP0703), 0.25 µl DreamTaq DNA Polymerase (ThermoFisher #EP0703 ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase II (5 U/ml, Gibco) for around 45 min at 37 °C in 5 % CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... and dispase II (5 U/ml, Gibco) at 37 °C in 5 % CO2 for 20 minutes followed by brief mechanical dissociation ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% fetal bovine serum (Gibco, #10270-106) and 50 μg/ml penicillin (HiMedia ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5 μM Draq5 (Thermo Fisher, 62251) in PEM buffer for 10 minutes at room temperature ...