Labshake search
Citations for Thermo Fisher :
1701 - 1750 of 10000+ citations for 5 OXO 5 6 7 8 TETRAHYDRO NAPHTHALENE 1 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: A375 cells were seeded at a density of 5×104 cells per well in 8 well Tek Chamber Slides (Nunc™, Thermo Fisher, USA) and incubated for 24 hours for stabilization ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA for real-time RT-PCR was isolated from rosette leaves of 25-day-old plants or 5-8 day-old roots using Trizol® reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: Purified CD11c+ myeloid cells (5 × 104 cells) from bone marrow cultures were plated on an 8 well glass chamber slide (Nunc Lab-Tek-Thermo Fisher) in supplemented IMDM medium and incubated for 24 h ...
-
bioRxiv - Cell Biology 2024Quote: ... Sept-7 1/800 (Thermo scientific, PA5-54755), GAPDH 1/5000 (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
REGN-COV2 antibody cocktail prevents and treats SARS-CoV-2 infection in rhesus macaques and hamstersbioRxiv - Microbiology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2020Quote: ... and ran in duplicate using the QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Immunology 2021Quote: ... Reactions were carried out on a QuantStudio 6 and 7 Flex Real-Time PCR System (Applied Biosystems) according to the manufacturer’s specifications ...
-
bioRxiv - Synthetic Biology 2023Quote: Protein thermal stability was measured by differential scanning fluorimetry using a QuantStudio Pro 6/7 (Applied Biosystems). Protein was brought to a concentration of 10 uM with 5x Sypro Orange dye in a final volume of 20 µL in 20 mM NaPi ...
-
bioRxiv - Genomics 2019Quote: ... 1 µg of each of the samples was combined with 5 µg Cot-1 DNA (15279011, ThermoFisher) and 1 µl of 1mM blocking oligo (5’ AGGTTAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAA 3’ ...
-
bioRxiv - Systems Biology 2020Quote: ... RNA was radioactively 5' end-labeled using 1 U μl−1 T4 polynucleotide kinase (Thermo Fisher Scientific) and 0.5 μCi μl−1 32P-γ-ATP (PerkinElmer ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1 μl 10 μM 5‘-biotinylated oligo-dT30VN (IDT) and 1 μl 10 mM dNTP (Thermo Scientific). Cells were sorted at one cell per well ...
-
bioRxiv - Plant Biology 2020Quote: ... The synthesized cDNA samples were diluted 1:5 with diethylpyrocarbonate (DEPC)-treated water (Ambion). Semi-quantitative RT-PCR was performed using 2 μl of diluted cDNA as template and gene-specific primers (Supplemental Table S3) ...
-
bioRxiv - Physiology 2022Quote: ... AM (5 µM from a stock concentration of 1 mM in DMSO, ThermoFisher Scientific) and Pluronic F-127 (0.02 % from a stock concentration of 20 % in DMSO ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Microbiology 2019Quote: ... and 5 μg.L−1 of epidermal growth factor (EGF) human recombinant (Thermo Fisher Scientific) (Wu et al ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 5 % fetal calf serum (PAN-Biotech) and 1 % Penicillin/Streptomycin (Thermo Fisher Scientific). The human Atoh8 expression plasmid [30] was transfected by electropulsing using the Cell Line Nucleofector System (Lonza ...
-
bioRxiv - Bioengineering 2021Quote: ... The composition of 1 L MM2 (pH = 6.9) was 5 g glucose (Acros Organics), 2.5 g of (NH4)2SO4 (Lach-Ner) ...
-
bioRxiv - Plant Biology 2021Quote: ... or 1/5 SuperSignal™ West Femto Maximum Sensitivity Substrate (34095, Thermo Fisher Scientific) was done using the ImageQuant LAS 4000 luminescent imager (GE Healthcare Life Sciences) ...
-
bioRxiv - Cell Biology 2021Quote: ... in (i) 300μl MTH buffer along with MitoProbe™ DiIC1(5) (1:300; Invitrogen) or (ii ...
-
bioRxiv - Cell Biology 2021Quote: ... and CellMask DeepRed (1:1000 dilution from 5 mg/ml stock solution, Invitrogen C10046) for 30 min ...
-
bioRxiv - Biochemistry 2022Quote: ... supplemented with 1× Halt Protease Inhibitor Cocktail and 5 mM EDTA (Thermo Fisher Scientific). Lysate was clarified by centrifugation and the total protein concentration was measured with the BCA Protein Assay (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Bioengineering 2019Quote: ... cells were passaged 1:5 to uncoated Petri dishes by adding trypLE (Life Technologies) for 5 minutes to dissociate the cells before being resuspended in growth medium and plated.
-
bioRxiv - Cell Biology 2019Quote: ... counterstained with DAPI (1:2000) for 5 minutes and mounted in ProLong Gold (Invitrogen). Actin was visualized by phalloidin-AF647 staining (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... silencer siRNAs (5 nM) for indicated genes or Negative Control siRNA #1 (Ambion, AM4611) were transfected with Lipofectamin RNAi MAX transfection reagent (Thermo Fisher Scientific ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... Triethylamine and 5-hehyn-1-ol 97% were purchased from Acros Organics (Geel, Belgium). Deuterium oxide (D2O ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μM DAF-FM diacetate and 1 μM LysoTracker Red DND-99 (Life Technologies), respectively ...
-
bioRxiv - Bioengineering 2022Quote: ... consisting of 5 μL TaqMan Fast Virus 1-Step Master Mix (cat# 4444432, Thermofisher), 1.2 μL forward primer (0.6 μm) ...
-
bioRxiv - Microbiology 2022Quote: ... approximately 1 gram of snottite biofilm was preserved in 5 parts RNAlater (Ambion, USA) within 4 hours of collection ...
-
bioRxiv - Molecular Biology 2022Quote: ... and high dose RNAse I (Thermo Fisher #AM2295; 1:5 diluted in cold DPBS) or low dose RNAse I (1:50 dilution for neurons ...
-
bioRxiv - Neuroscience 2023Quote: ... and DAPI (D1306, Thermo Fisher Scientific, 1:500 from a 5 mg/ml stock). All reactions were performed in FACS buffer and incubated for 20 min at 4°C ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by 1 hour of blocking with normal goat serum (NGS) (5%, Invitrogen, #10000C). Primary antibodies raised against NaV1.1 (1:500 ...
-
bioRxiv - Molecular Biology 2023Quote: ... in PBS for 45 min and 1% formaldehyde for 5 min (Thermo Scientific 28908). The reaction was quenched with 0.125 M glycine ...
-
bioRxiv - Pathology 2023Quote: The cDNA was then diluted by 1:5 in nuclease-free water (#10526945, ThermoFisher). qPCR was performed using 2x PCRBIO Sygreen Blue Mix Hi-ROX (#PB20.16-20 ...
-
bioRxiv - Neuroscience 2023Quote: ... immunoblotted with anti-ubiquitin antibody 1:500 in 5% BSA TBST (13-1600, Invitrogen) and reprobed with anti-C-cadherin antibody 1:100 in 5% non-fat milk TBST (Developmental Studies Hybridoma Bank ...
-
Phosphorylation controls spatial and temporal activities of motor-PRC1 complexes to complete mitosisbioRxiv - Biochemistry 2023Quote: ... cells were incubated for 5 minutes with CellMask orange (1:40000, Thermo Fisher Scientific) and 5 minutes with SPY650 (1:1000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rabbit anti-Keratin 5 (1:200; clone EP1601Y; MA5-14473; RRID:AB_10979451; Thermo Fisher Scientific), rabbit anti-SFTPC (1:200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% FBS and 1% penicillin-streptomycin (all from Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Microbiology 2023Quote: ... containing 5 µl of template and TaqMan Fast Virus 1-step mastermix (Applied Biosystems). Primer sequences and concentrations and thermal cycling conditions for SARS-CoV-2 nucleocapsid 1 gene were as previously described (13) ...
-
bioRxiv - Microbiology 2023Quote: ... incubated for 1 hour in blocking solution containing Hoechst 33342 (Invitrogen; 5 µg/ml) and secondary antibodies labeled with AlexaFluor 488 or AlexaFluor 555 (Invitrogen ...
-
bioRxiv - Immunology 2024Quote: ... or with Deep Red Anthraquinone 5 (DRAQ5, dilution 1:500 in PBST 0,05%; Invitrogen), before mounting with ProLong Gold anti-fade reagent (Invitrogen).
-
bioRxiv - Cell Biology 2023Quote: ... or TMTpro™ 16 plex Label Reagent Set 1 x 5 mg (ThermoFisher: A44520) for whole-cell protein quantitation ...
-
bioRxiv - Genetics 2023Quote: ... samples were washed and incubated in 1:10000 DAPI (Invitrogen, D1306, 5 mg/mL) for 5min ...
-
bioRxiv - Immunology 2023Quote: ... TriLink) and all four nucleotides with 1-methylpseudouridine-5’-triphosphate (m1ΨTP; Thermo Fisher Scientific) substituting for uridine-5’-triphosphate (UTP ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were pelleted down by centrifugation (10628 g at 25°C for 5 min, Thermo Fisher SCIENTIFIC #F9-6 x 1000 LEX rotor). Cells were washed once with water and suspended into 75 mL ice cold water ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were pelleted down by centrifugation (10628 g at 25°C for 5 min, Thermo Fisher SCIENTIFIC #F9-6 x 1000 LEX rotor). The cells were washed once with sterilized water and re-suspended into 6 L MM composed of 1.34% yeast nitrogen base without amino acids (SIGMA Y0626) ...
-
bioRxiv - Microbiology 2021Quote: Keratinocytes were seeded at a density of 5×105 cells/well in a 6-well tissue culture plate (Nunc; Thermo Fisher Scientific, Singapore) and grown for 3 days at 37°C in a 5% CO2 humidified atmosphere ...