Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for 6 IODO BENZO D 1 3 OXAZIN 4 ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Samples were stained for one hour with phalloidin Alexa fluor 488 (1:300, ThermoFisher, A12379) or phalloidin Alexa fluor 568 (1:300 ...
-
bioRxiv - Genomics 2024Quote: ... one third of the vegetative stage cells were resuspended in 1 ml TRIzol Reagent (Invitrogen) and stored at −20°C until further processing ...
-
bioRxiv - Microbiology 2023Quote: ... RNA quality was verified by 1% agarose electrophoresis and quantified using Nanodrop One (Thermo Scientific). As control ...
-
bioRxiv - Molecular Biology 2024Quote: ... and checked on 1% agarose gel and concentration measured with a NanoDrop One spectrophotometer (ThermoFisher). Double-stranded RNA targeting the gene encoding the green fluorescent protein (dsGFP ...
-
Efficient Suppression of Endogenous CFTR Nonsense Mutations Using Anticodon Engineered Transfer RNAsbioRxiv - Molecular Biology 2021Quote: ... one-step reverse transcriptase and quantitative PCR (RT-qPCR) was performed on the QuantStudio 3 Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) using the Luna Universal One-Step RT-qPCR Kit (New England BioLabs ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5’ TCTCGCTGGGGACTCTGGTTGAAAT 3’) primers (Eurofins, Louisville, KY) and SuperScript™ III One-Step RT-PCR kit with Platinum™ Taq DNA Polymerase (Invitrogen, Carlsbad, CA) using the following thermocycler conditions ...
-
bioRxiv - Neuroscience 2024Quote: ... 20 ng/mL Interleukin-6 (IL-6) (Thermo Fisher Scientific), 20 ng/mL Interleukin-3 (IL-3 ...
-
bioRxiv - Immunology 2021Quote: ... and 1 mM dithiothreitol) and 50 μL of 1 mM d-luciferin potassium salt (ThermoFisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... and 1 mM dithiothreitol) and 50 μL of 1 mM D-luciferin potassium salt (ThermoFisher Scientific).
-
bioRxiv - Genetics 2020Quote: ... Antibodies were NKX2-5 (mouse, R&D, 1:500) and β -actin (rabbit, Invitrogen, 1:1000). Subsequently ...
-
bioRxiv - Bioengineering 2024Quote: ... Drug selection began 2 d post transduction with 1 μg/mL puromycin (Invitrogen, ant-pr-1). Cells were kept in antibiotics for at least two weeks with subculturing every one to two days before further characterization.
-
bioRxiv - Microbiology 2024Quote: ... Controls were provided by cells treated with actinomycin D (Invitrogen, 1 µM; 1 h before labeling), RG7834 (0.05 µM ...
-
bioRxiv - Neuroscience 2021Quote: ... We used primary antibody mouse anti-HuC/D (1:500, Invitrogen, 16A11). Secondary detection was performed with goat anti-mouse IgG1 Alexa 488 (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... and cell nuclei counterstained with DAPI (1:1000; Invitrogen D-1306; RRID:AB_2629482). The 3A10 monoclonal antibody is neuron-specific(29) ...
-
bioRxiv - Cell Biology 2021Quote: ... Dermal sheets were digested with 1 mg/ml collagenase D (Gibco, USA) in complete RPMI 1640 medium/10% FCS for 45 min at 37°C in a thermomixer at 1400 rpm ...
-
bioRxiv - Systems Biology 2022Quote: ... Then cryosections were incubated with Bodipy (Life Technologies, D-3922, 1:250) for 30 min After rinsing steps with 60% isopropanol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Primary antibodies used were: rabbit anti-HuC/D (1:500, 16A11 - Invitrogen), mouse anti-Zrf1 (1:100 - ZIRC ...
-
bioRxiv - Immunology 2022Quote: ... pH 7.5) containing 1% n-dodecyl-b-D-maltoside (DDM; Thermo Scientific). The resultant samples were resuspended in 1X Laemmli buffer containing 5% β-Mercaptoethanol (Bio-Rad) ...
-
bioRxiv - Neuroscience 2022Quote: ... DAPI nucleic acid stain (1:1000, Invitrogen, Waltham, MA, USA, D-1306) was used to counterstain prior to the final washes in 1× PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 x 105 cells/well were seeded in poly-D-lysine (Thermofisher) coated XFe96 plates ...
-
bioRxiv - Biophysics 2024Quote: ... then induced with 0.4 mM isopropyl ß-D-1-thiogalactopyranoside (Thermo Fisher) according to the vector standard protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... Induction was done with IPTG (Isopropyl β-D-1-thiogalactopyranoside) (Thermofisher Scientific) at a final concentration of 0.1mM ...
-
bioRxiv - Genetics 2021Quote: ... containing a 4:1:1 mixture of Lipofectin transfection reagent (ThermoFisher Scientific), water and BAC DNA (~ 15 μg DNA per larva) ...
-
bioRxiv - Immunology 2021Quote: ... Membranes were blocked with 5% BSA in TBST buffer and probed with anti-mouse Tim-3 goat polyclonal antibody (R&D) and detected with anti-goat-HRP antibody and SuperSignal West Pico Chemiluminescent reagent (Thermo Fisher).
-
bioRxiv - Immunology 2020Quote: ... D-PBS (D-PBS without Ca++ and Mg++) supplemented with 2% FBS and 3 mM cell culture grade EDTA (Life Technologies; Thermofisher) prior to monocyte isolation ...
-
bioRxiv - Neuroscience 2024Quote: ... using 200 psi and µm tungsten particles coated with fluorescent 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate (DiI, Thermo Fisher Scientific; D-282). The DiI was allowed to diffuse at r.t ...
-
bioRxiv - Pathology 2023Quote: ... which was previously labeled at its 5’ end with one of four specific fluorescent dyes (6-FAM®, NED®, PETTM and VICTM; Thermo Fisher Scientific, Waltham, MA, U.S.A) (Table 2) ...
-
bioRxiv - Cell Biology 2024Quote: ... a premium microscope slide (Fisher-finest, 3″ × 1″ × 1 mm; Thermo Fisher Scientific, 12-544-1) or chambered coverglass (1 well ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Plant Biology 2021Quote: ... these were extracted and dialyzed against 25 mM Tris pH 7.5 at 4 °C and measured using a Nanodrop One (Thermo Fisher Scientific, Waltham, MA). Particles for cryo-EM were dialyzed against 20 mM NaOAc ...
-
bioRxiv - Systems Biology 2020Quote: ... and 4 μL of this dilution were used to transform One ShotTM ccd B Survival 2 T1R competent cells (Thermo Fisher Scientific, A10460). Transformants were selected with 33 μg/mL chloramphenicol (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... The slices were incubated at 4°C for one day in PBT with 0.002% Streptavidin conjugated to Alexa Fluor 633 (ThermoFisher Scientific, Waltham, MA, USA), then washed two times in PBT and two times in PB ...
-
bioRxiv - Cancer Biology 2024Quote: ... They were then washed twice with Blocking One (Nacalai Tesque, 03953-95) and incubated overnight at 4 °C with primary antibodies diluted in 10% goat serum (Thermo Fisher Scientific, 16210064)/Blocking One ...
-
bioRxiv - Developmental Biology 2019Quote: ... pH=6 (ThermoFisher). Sections were then blocked for 1h at RT with 10% normal donkey serum (Chemicon International Inc ...
-
bioRxiv - Biochemistry 2024Quote: ... or 6% (Thermofisher) tris-glycine SDS-PAGE gels then transferred onto PVDF membranes using the Transblot rapid transfer machine (BioRad) ...
-
bioRxiv - Neuroscience 2021Quote: ... hippocampal cells were plated onto poly-D-lysine-coated coverslips framed in a Nunc™ 4-well dish (Thermo Fisher) at a cell density of 20,000–30,000 cells/cm2 and grown in Neurobasal™ medium (Thermo Fisher ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μL of 10 mM NBD-(linezolid-7-nitrobenz-2-oxa-1,3-diazol-4-yl)-amino-D-alanine (NADA) (Thermo Fisher) was added to each tube and incubated at 37° C ...
-
bioRxiv - Cell Biology 2022Quote: HTM hydrogels on coverslips subjected to the different treatments for 10 d were fixed with 4% paraformaldehyde (Thermo Fisher Scientific) at 4ºC overnight ...
-
bioRxiv - Cancer Biology 2020Quote: ... obtained as formerly described [66]) were cultured in DMEM with 4 mM L-glutamine and 25 mM D-glucose (ThermoFisher) supplemented with 10% (v/v ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were grown on 4-well glass chamber slides coated with poly-D-lysine (Thermo Fisher Scientific, Waltham, MA, USA). About 70,000 cells were seeded in each chamber well with a total aliquot of growth medium of 1 ml ...
-
bioRxiv - Microbiology 2024Quote: ... were carried out by allowing 20-100 µL of cells fixed with 4% paraformaldehyde (diluted in RPMI or PBS) to settle on poly-D-lysine (GIBCO) coated slides for 15 minutes ...
-
bioRxiv - Neuroscience 2021Quote: ... 1:6 and 1:9 or 1:10 and 1:100) of ISF samples were prepared using OPTIMEM+ Glutamax-1 (Gibco #51985-026) and kept on ice until lipofection ...
-
bioRxiv - Developmental Biology 2024Quote: ... Feeder-depleted serum cultured ESCs were plated on gelatin-coated plates at 10,000 cells/cm2 (90,000 cells per well in a 6-well plate) in advanced N2B27 defined media composed of a 1:1 mix of 1:1 DMEM/F12 (Invitrogen, 12634-010) and Neurobasal medium (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... only 4 μL of 1 mM FM 4-64 (Cat. number T13320, Thermo Fisher, Waltham, MA) was injected ...
-
bioRxiv - Biophysics 2019Quote: ... Cells were transfected with 1:1 mEmerald-Zyxin-6 to mCherry-Paxillin-22 using Lipofectamine 3000 (ThermoFisher) per the manufacturer’s protocol and allowed to grow for 24 hours ...