Labshake search
Citations for Thermo Fisher :
1651 - 1700 of 10000+ citations for 6 Chloro 9 3 N 2 chloroethyl ethylamino propylamino 2 methoxyacridine dihydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... both human primary myogenic progenitors isolated from female donors (n=2-5 per experiment) and commercialised human primary skeletal muscle progenitors (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... These two proteins were labeled at the cysteine using thiol-reactive BODIPY™ FL N-(2-Aminoethyl) Maleimide (Thermo Fisher). The proteins were mixed with 10-fold excess BODIPY™ FL N-(2-Aminoethyl ...
-
bioRxiv - Microbiology 2020Quote: ... One-step RT-qPCR was performed with primers targeting the SARS-CoV-2 N region (BEI) using the EXPRESS One-Step Superscript qRT-PCR Kit (ThermoFisher) on an Applied Biosystems QuantStudio3 instrument ...
-
bioRxiv - Neuroscience 2022Quote: ... Maturation medium I was DMEM/F12 supplemented with 100 U/ml Penicillin-Streptomycin and 1% N-2 Supplement (Gibco, 17502048). On day 10 ...
-
bioRxiv - Neuroscience 2024Quote: ... NPC were plated on poly- L-ornithine/laminin-coated flasks at 50’000 cells/cm2 in2µg/ml laminin-supplemented neural expansion medium (DMEM/F-12 + Glutamax, Gibco®; 1x N-2 supplement, Gibco® ...
-
bioRxiv - Neuroscience 2023Quote: ... and incubated in culture media (66% BME, 25% Hanks, 5% FBS, 1% N-2, 1% penicillin, streptomycin and glutamine; all from Invitrogen) and 0.66% D-(+)-Glucose (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... Domes were polymerised by incubation for 15 minutes at 37°C and Advanced DMEM media supplemented with 1x N-2 (Gibco), 1x B-27 (Gibco) ...
-
bioRxiv - Cell Biology 2023Quote: Full-length cDNA sequence of Hs WDR23 Isoforms 1 and 2 were cloned into pcDNA 6.2/N-EmGFP/TOPO (Thermo Fisher), as previously described [19] ...
-
bioRxiv - Immunology 2023Quote: ... and stained for SARS-CoV-2 N protein using Biotin-labelled-CR3009 antibody produced in-house together with a Streptavidin-Alexa488 (S32354, Invitrogen) and cellular DNA using DAPI (10236276001 ...
-
bioRxiv - Neuroscience 2022Quote: ... the medium was changed to neural induction media (1:1 mixture of DMEM/F-12 GlutaMAX: Neurobasal media supplemented with 0.5x N-2 (Life Technologies), 0.5x B-27 (Life Technologies) ...
-
bioRxiv - Genetics 2020Quote: Total RNA was isolated from gonadal adipose tissue (eWAT; n = 9) samples using the Ambion RiboPure (Thermo Fisher Scientific). RNA was quantified in a Nanodrop ND-1000 spectrophotometer and RNA purity and integrity was checked by using a Bioanalyzer-2100 equipment (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: Northern blots were performed as previously described with infrared probe and EDC (N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide) (Thermo Scientific) crosslinking43 ...
-
bioRxiv - Biochemistry 2023Quote: ... and Glycerol-3-Phosphate (cat. N° 20729) were from Cayman. Schneideŕs Drosophila medium (cat. N° 21720024) was from Gibco. ADP ...
-
bioRxiv - Physiology 2022Quote: ... the fluorescent glucose analog 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG; 6.83 μg/kg BW, Invitrogen) dissolved in 50% dextrose (1 g/kg BW ...
-
bioRxiv - Neuroscience 2021Quote: ... the Ca+2 indicator Fluo-4-AM (Molecular Probes, Eugene, OR; 2–5 µl of 2 mM dye) were dropped over S1 cortex ...
-
bioRxiv - Immunology 2021Quote: ... Substrate (OPD, O-phenylenediamine dihydrochloride, Thermo Scientific) was added ...
-
bioRxiv - Immunology 2019Quote: ... Dihydrochloride (Molecular Probes, Cat#D1306, 1:10,000) and cover-slipped ...
-
bioRxiv - Cell Biology 2021Quote: ... Dihydrochloride (DAPI; Life Technologies #D1306; 1:170).
-
bioRxiv - Physiology 2021Quote: ... Dihydrochloride (DAPI) (ThermoFisher Scientific, London, ON, Canada) (1:300 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... 91 μM puromycin dihydrochloride (Thermo Fisher Scientific) was added to media 5 minutes prior to harvesting and incubated at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... Dihydrochloride (DAPI) (1:10,000, Life Technologies, D1306) was used to stain cell nuclei for rod quantification.
-
bioRxiv - Neuroscience 2024Quote: ... we added puromycin dihydrochloride (Gibco; A11138-03) at 10ug/mL to the motor neuron media and incubated at 37C for 10 minutes ...
-
A conserved germline-specific Dsn1 alternative splice isoform supports oocyte and embryo developmentbioRxiv - Cell Biology 2024Quote: ... Dihydrochloride (DAPI; Life Technologies #D1306; 1:170).
-
bioRxiv - Genetics 2024Quote: ... Dihydrochloride (DAPI; Life Technologies #D1306; 1:170).
-
bioRxiv - Cancer Biology 2019Quote: ... in a 2:2:1 molar ratio using lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... and THPTA in ratio 1:2:2 in HBSS (Gibco #14025092). The later two components were also dissolved in water and a stock solution of 10 mM concentration each was prepared ...
-
bioRxiv - Cell Biology 2021Quote: Cardiomyocytes were loaded with 2 μM Fura-2 (Thermo Fisher, F1201) in Tyrode’s solution for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 1 ug/ml of interleukin-2 (IL-2; Gibco BRL) in complete RPMI 1640 containing 2mM L-glutamine ...
-
bioRxiv - Neuroscience 2020Quote: Cells were loaded with 2 μM fura-2 AM (ThermoFisher Scientific) in BSS for one hour at 37 °C and rinsed twice with BSS (Gibson et al ...
-
bioRxiv - Cancer Biology 2019Quote: ... in a 2:2:1 molar ratio using lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Fura-2 pentaacetoxymethyl ester (fura-2/AM) was from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 mM GlutaMax supplemented with 2% (wt/vol) B27 (GIBCO) and 10% FBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a 2:2:1 molar ratio using lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... The 6-well plates were previously coated with Vitronectin-N (Thermo Fisher Scientific; A14700). Y-27632 (Fujifilm Wako ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were mounted on ProLong Gold with 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, Waltham, MA, USA) and imaged using a Delta-Vision II microscope system with an Olympus IX-71 inverted microscope using a 100x objective A ...
-
bioRxiv - Molecular Biology 2020Quote: ... Slides were mounted in ProLong™ Gold Antifade Mountant containing 4’,6’-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific). Images were acquired at 100x magnification using a Nikon Eclipse Ti fluorescence microscope fitted with a Hamamatsu C11440 digital camera ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl cDNA (diluted 1:20) was used in a 6 µl Fast SYBR Green qPCR reaction (ThermoFisher Scientific). No-template controls for each gene were run in all qPCR plates ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...
-
bioRxiv - Microbiology 2020Quote: ... Finally samples were counter stained for nucleus with 1 μM DAPI (4′, 6-diamidino-2′-phenylindoldihydrochloride; Thermo Fisher Scientific). Zeiss inverted Axio Observer fluorescent microscope (Zeiss ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were stained with 4′,6-diamidino-2-phenylindole and were embedded with ProLong Gold mounting medium (Life Technologies). ImageJ/Fiji software (National Institutes of Health ...
-
bioRxiv - Neuroscience 2020Quote: Human sections were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) and coverslips were mounted using Prolong Gold (Invitrogen) for imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... the cells were mounted in ProLong Gold antifade reagent supplemented with 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes). Conventional immunocytochemical staining was done to quantify the activated PAK1 and actin in oAβ and IPA-3 treated cells using phospho-PAK1 (Thr423)/PAK2 (Thr402 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Chromosomes were counterstained for 20 minutes with 1 μg/ml DAPI (4’,6-diamidino-2-phenylindole; ThermoFisher Scientific, D3571) in 2x SSC ...
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 (438-516) S-RBD((HiS)6 and biotynilated human ACE2 have been purchased from Fisher Scientific (respective references 16534204 and 16545164) ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then washed twice with PBS and stained with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Scientific #D1306) diluted 1:200 in 0.5% BSA in PBS ...
-
bioRxiv - Systems Biology 2022Quote: ... Cells were mounted with the ProLong™ Diamond Antifade Mountant with 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher Scientific). Ki-67 signals were visualized with Nikon microscopy ...
-
bioRxiv - Neuroscience 2020Quote: ... Coverslips were affixed using Prolong Gold Antifade Mountant with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher Scientific, Cat. # P36935).
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated at 1 x 10^6 cells per well of a 6 well plate or 5 x 10^6 cells per T25 flask in stage 2 media consisting of 47.5% IMDM (Gibco), 47.5% F12 (Gibco) ...