Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 7943 citations for Recombinant Human Leptin Receptor His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2020Quote: ... The recombinant plasmids were extracted with PureLink Quick Plasmid Miniprep Kit (Invitrogen) from successful clones.
-
bioRxiv - Biochemistry 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac system (ThermoFisher Scientific), and sNrk was expressed in Sf9 cells grown in ESF921 medium (Expression Systems) ...
-
bioRxiv - Immunology 2021Quote: The recombinant baculovirus was amplified in Sf9 cells (Thermo Fisher Scientific, USA) to a density of 2 × 106 cells/mL in ExCell 420 medium (Sigma Aldrich ...
-
bioRxiv - Biophysics 2019Quote: Recombinant APC/C was expressed in High Five insect cells (Thermo Scientific) as described in30,42 ...
-
bioRxiv - Immunology 2022Quote: ... The recombinant bacmids were obtained from Bac-to-Bac system (Life Technologies). Baculoviruses were produced by transfection of bacmid DNA into Sf9 cells and used to infect High Five cells (Life Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... PCR reactions were carried out using Recombinant Taq DNA Polymerase (Thermo Scientific) and standard PCR cycling conditions.
-
bioRxiv - Microbiology 2022Quote: ... Recombinant SARS-CoV-2 RBD were purified by nickel affinity columns (Invitrogen) while ACE2-Fc and antibodies were purified by protein A affinity columns (Cytiva ...
-
bioRxiv - Synthetic Biology 2020Quote: ... were used to generate recombinant bacmids according to the manufacturer’s protocol (Invitrogen). Insertion of the gene into the bacmid was verified by PCR ...
-
bioRxiv - Plant Biology 2021Quote: ... The recombinant bacmid was transfected into Sf9 insect cells using Lipofectamine (Invitrogen) according to the manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... The recombinant plasmids were transformed into INVSc1 Saccharomyces cerevisiae (Thermo Fisher Scientific) using the PEG-LiAc method ...
-
bioRxiv - Systems Biology 2020Quote: ... The proteins were acetone precipitated prior to digestion with recombinant trypsin (ThermoFisher) (1:50 wt/wt. ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA). 2 μL of ten-fold diluted RNA template in duplicates was added in a total volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... and 16 U of RNaseOUT™ Recombinant Ribonuclease Inhibitor (Life Technologies, USA) was used ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was diluted to 2.5 μg/mL in PBS (Fisher Scientific) and 100 μl of the dilution was distributed in the wells of flat-bottom 96-well microplates (Immulon 2HB ...
-
bioRxiv - Immunology 2020Quote: ... Recombinant RBD was transiently expressed in Expi293™ (Thermo Fisher Scientific, UK) and protein purified from culture supernatants by immobilised metal affinity followed by a gel filtration in phosphate-buffered saline (PBS ...
-
bioRxiv - Immunology 2020Quote: Recombinant HIV-1 Env gp120 was expressed in Freestyle 293 cells (ThermoFisher) by transient transfection ...
-
bioRxiv - Developmental Biology 2021Quote: ... along with 1 unit of RNaseOUT Recombinant RNase Inhibitor (Invitrogen Cat. 10777019) and 1 mM MgCl2 (Thermo Fisher Scientific Cat ...
-
bioRxiv - Microbiology 2021Quote: ... The recombinant proteins were expressed using the Expi293 Expression system (ThermoFisher Scientific) and purified with HisTrap FF columns (for polyhistidine-tagged spike proteins ...
-
bioRxiv - Cancer Biology 2021Quote: A recombinant Streptococcus pyogenes Cas9 (GeneArtTM Platinum Cas9 Nuclease, Thermo Fisher Scientific) together with a single-guided RNA (GTAAAGCAGGGCTACATGAG ...
-
bioRxiv - Cancer Biology 2022Quote: ... 50 µg/ml mouse recombinant epidermal growth factor (EGF; Thermo Fisher Scientific), 10nM [Leu15]-gastrin I (Merck) ...
-
bioRxiv - Bioengineering 2022Quote: ... putida recombinants was quantified using Trace 1310 Gas Chromatograph (Thermo Fisher Scientific) equipped with ZB-WAX plus column (30 m ...
-
bioRxiv - Cell Biology 2022Quote: ... Recombinant baculoviruses were prepared in Spodoptera frugiperda (Sf9) cells using Cellfectin (Invitrogen) following the Bac-to-Bac protocol (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: ... recombinant baculoviruses were produced using the ViraPower BacMam Expression System (Thermo Fisher). In brief ...
-
bioRxiv - Immunology 2022Quote: ... The supernatant containing recombinant antibody was incubated with protein A resin (ThermoFisher) overnight at 4 °C ...
-
bioRxiv - Biophysics 2024Quote: ... Recombinant CtNAT10 protein was expressed in both Sf9 cells (ThermoFisher, cat #12659017) and homemade bGroESL cells (See Experimental Model and Subject Details) ...
-
bioRxiv - Plant Biology 2023Quote: ... 2 μL of RNaseOUT™ Recombinant RNase Inhibitor (40 units/μL, Invitrogen) and 2 μL of SuperScript™ III RT (200 units/μL ...
-
bioRxiv - Synthetic Biology 2023Quote: All recombinant proteins were produced in Escherichia coli BL21(DE3) pLysS (Invitrogen) transformed with respective plasmids ...
-
bioRxiv - Microbiology 2023Quote: ... 0.1 U Uracil N-glycosylase and 0.5 U recombinant Taq polymerase (Invitrogen). Quantitative real-time PCR was run with initial incubation at 25°C for 30 min ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant baculovirus expressing A2AR was prepared using Bac-to-Bac system (Invitrogen). Spodoptera frugiperda 9 (Sf9 ...
-
bioRxiv - Cell Biology 2022Quote: Recombinant H2 was expressed in Invitrogen™ 293FT cells (Thermo Fisher Scientific). 293FT cells were cultured in Gibco™ DMEM (high glucose ...
-
bioRxiv - Immunology 2023Quote: Recombinant antibodies were generated using the Expi293 or Expi293 FUT8−/- system (ThermoFisher) using previously described protocols (60) ...
-
bioRxiv - Neuroscience 2023Quote: ... while for the short we used the Taq DNA Polymerase Recombinant (Invitrogen) kit ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Recombinant protein was extracted using BugBuster Protein Extraction Reagent (Thermo Scientific, USA) and purified using cOmplete His-Tag Purification Resin (Roche ...
-
bioRxiv - Biophysics 2023Quote: Recombinant tubulin was purified by using Bac-to-Bac system (Life Technologies) as described previously18 ...
-
bioRxiv - Biophysics 2023Quote: ... recombinant baculoviruses were prepared using the Bac-to-Bac expression system (Invitrogen). The proteins were expressed in Trichoplusia ni (BTI-Tn5B1–4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... with the addition of RNaseOUT recombinant ribonuclease inhibitor (ThermoFisher Scientific 10777-019) as per manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... supernatants or serial dilutions of mouse IL2 recombinant protein (Peprotech, ThermoFisher Scientific) (100 μL/well ...
-
bioRxiv - Cancer Biology 2024Quote: ... 500 ng/mL recombinant RSPO1 (Thermo Fisher Scientific, cat# 120-38-500UG), and 100 ng/ml recombinant noggin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cholera Toxin Subunit B (Recombinant) Alexa Fluor 488TM Conjugate (C34775, Invitrogen, Belgium), Tetramethylrhodamine ...
-
bioRxiv - Microbiology 2024Quote: ... 0.5μL of 40U/μL of RNaseOUT recombinant ribonuclease inhibitor (Invitrogen, #10777-019), and 0.5μL 200 U/μL SuperScript III reverse transcriptase ...
-
bioRxiv - Genomics 2020Quote: For Hi-C experiments knockdown of CLAMP was validated using the Western Breeze kit (Invitrogen). Antibodies used for detection were a previously described custom rabbit antiCLAMP (1:1,000 ...
-
bioRxiv - Genomics 2020Quote: The psep-1::his-58::eGFP transgene was generated using three-site Gateway cloning (Invitrogen) in the MosSCI compatible vector pCFJ150 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 10 % heat-inactivated fetal bovine serum (HI FBS, Thermo Fisher Scientific, Loughborough, UK) and antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin ...
-
bioRxiv - Microbiology 2019Quote: ... A 1:150 dilution of anti-His antibody labelled with AF647 (Thermo Fisher, Waltham, MA) was then added to cells ...
-
bioRxiv - Cell Biology 2019Quote: ... The His-mCherry-fusion proteins were purified using a Ni-NTA column (Thermo Fisher Scientific). The eluted proteins were dialyzed in 1 L dialyzed buffer (20 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Microbiology 2019Quote: ... mouse anti-6x-His epitope tag monoclonal antibody (Thermo Fisher Scientific, Cat. No. MA1-21315); LI-COR IRDye 800CW goat anti-rabbit IgG (LI-COR ...
-
bioRxiv - Molecular Biology 2019Quote: ... The Jpx E1-E3 isoform was cloned into pEF1/V5-His vector (Invitrogen Cat# V92020), which contains an EF-1α promoter for mammalian expression and a T7 promoter for in vitro transcription ...
-
bioRxiv - Synthetic Biology 2019Quote: ... Im7-6 was purified from IVG reactions using magnetic His-tag Dynabeads (Thermo Fisher Scientific). The IVG reactions were diluted in 90 µl of Buffer 1 (50 mM NaH2PO4 and 300 mM NaCl ...
-
Genomic approach for conservation and the sustainable management of endangered species of the AmazonbioRxiv - Genomics 2020Quote: ... One microliter of amplification was mixed with 8.5 μL Hi-Di deionized formamide (Applied Biosystems), and 0.5 μL GeneScan 500 LIZ (Applied Biosystems ...
-
bioRxiv - Biochemistry 2021Quote: ... Cleaved 14His-SUMO and His-Ulp1 were removed by affinity to Ni-NTA Agarose (Invitrogen). The flowthrough was diluted 1:5 with MonoQ buffer A and loaded onto a MonoQ 5/50 GL column (GE Healthcare) ...