Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 7943 citations for Recombinant Human Leptin Receptor His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: The Avi-tagged BG505 gp140.664.R1 trimer probe was transiently expressed in HEK293F cells (Thermo Fisher) (67) ...
-
bioRxiv - Molecular Biology 2021Quote: ... Protein A-tagged proteins were detected with HRP-conjugated polyclonal anti-Protein A (Invitrogen, PA1-26853) at 1:5000.
-
bioRxiv - Immunology 2020Quote: ... The resultant FLAG-tagged STAT3 constructs were transfected into 293T using lipofectamine 3000 (Thermo Fisher Scientific). 48 hours after transfection cells were lysed (50mM Tris ...
-
bioRxiv - Genetics 2019Quote: ... Proteins tagged with the V5 epitope (Hxk2, Reg1) were detected with the Anti-V5 probe (Invitrogen) diluted 1:1,000 ...
-
bioRxiv - Plant Biology 2022Quote: ... GST and GST-tagged SAMS were incubated with 40 μl GST magnetic beads (Thermo Fisher Scientific) for 1 h at 4°C and then these beads were washed three times with lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tagged gDNA was enriched using Dynabeads™ MyOne™ Streptavidin C1 (Thermo Fisher Scientific, Cat. 65001). The beads were allowed to room temperature while being resuspended on a HulaMixer™ Sample Mixer (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... the cells were probed with donkey anti-mouse secondary antibody tagged with Alexa Fluor 568 (Invitrogen), for 1 h in dark ...
-
bioRxiv - Microbiology 2023Quote: ... we used PrepEase Histidine-tagged Protein Purification Midi Kit-High Yield (Affymetrix, Santa Clara, CA, USA) or Protino Ni-IDA 2000 packed columns (Macherey-Nagel ...
-
bioRxiv - Microbiology 2023Quote: Mono-Fc tagged PvDBP-RII used for SAXS experiments was expressed in Expi293 cells (Thermo Scientific) as described above and purified using the CaptureSelect C-tagXL Affinity Matrix (Thermo Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... Flag-tagged proteins were immunoprecipitated with anti-Flag magnetic agarose (Pierce Anti-DYKDDDDK Magnetic Agarose, ThermoFisher), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... and stained with Alexa Fluor 555-tagged donkey-α-goat secondary antibody (Molecular Probes, 1:1000) for 1 hour ...
-
bioRxiv - Biophysics 2023Quote: ... Hexa-histidine tagged mTHSD7A fragments were purified under native conditions using Ni-NTA resin (Thermo Scientific) applying the batch method according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Rab7a and LAMP1 wt and mutant molecules tagged with EGFP using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... WRN Halo-tagged HCT-116 cells were seeded in FluoroBrite DMEM (Thermo Fisher, cat. no. 1896701) supplemented with 10% FBS (Corning) ...
-
bioRxiv - Microbiology 2024Quote: ... ∼300RU of each Fc-tagged KIR2DL1 and KIR2DS1 were captured via Protein A/G (ThermoFisher Scientific) pre-immobilized on a CM5 sensor (∼1500 RU on each flow cell) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Tissues from Knock-in LAP-tagged PAF1C flies were detected with anti-V5 tag (Invitrogen, R96025) 1:500 in BBX incubated overnight at 4°C with nutation ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: Short hairpin RNAs against the mu and delta receptors were designed using BLOCK-IT RNAi Designer software (Invitrogen, USA). The sequences of the 21-nt fragments complementary to the target mRNAs were GCTGCCCTTTCAGAGTGTTAA (Oprm1-1) ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNA encoding the short transcriptional variant of human DA D2 receptor with an N-terminal FLAG tag (SF-D2R-S) was inserted into mammalian expression vector pcDNA 3.1(+) (Invitrogen)62 ...
-
bioRxiv - Cell Biology 2020Quote: ... the surface receptors were labeled with 0.133 mg/ml of EZ-Link Sulfo-NHS-SS-Biotin (Thermo scientific, 21331) in PBS at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2019Quote: ... and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R) (32) were maintained at 37°C in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) supplemented with 10% serum (HyClone FetalClone II ...
-
bioRxiv - Immunology 2022Quote: ... This master mix was added to premade 96 well TaqMan Array plates with chemokine/chemokine receptor primers (Thermo Fisher, Mouse Chemokines & Receptors Array plate ...
-
bioRxiv - Neuroscience 2019Quote: ... a cDNA encoding this receptor was cloned into the eukaryotic expression vector pcDNA 3.1(+) (Invitrogen; Cat. No. V790-20). To facilitate expression of the cloned receptor ...
-
bioRxiv - Immunology 2020Quote: ... pH 7.2) resuspended and incubated for 30 min in FACS buffer supplemented with Fc gamma receptor CD16/CD32 antibodies (ThermoFisher). Cells were then incubated with Alexa fluor 488-conjugated antibodies against F4/80 or rat IgG2a kappa isotype control ...
-
bioRxiv - Immunology 2020Quote: ... Reverse sICs were generated from these receptor-specific antibodies using goat-anti-mouse IgG F(ab)2 fragments (Invitrogen) in a 1:1 ratio ...
-
bioRxiv - Microbiology 2021Quote: Vero cells that stably express the canine receptor CD150 (Vero-cCD150) were grown in advanced Dulbecco’s modified Eagle medium (DMEM; Gibco) supplemented with 10% (V/V ...
-
bioRxiv - Neuroscience 2023Quote: ... The following primary antibodies were used: rabbit polyclonal anti-GPR10 receptor (1:200; PA5-29809 Thermo Scientific, Paisley, UK); rabbit polyclonal anti-NPFF2 receptor (1:200 ...
-
Analysis of RyR2 distribution in HEK293 cells and mouse cardiac myocytes using 3D MINFLUX microscopybioRxiv - Physiology 2023Quote: ... after the samples were blocked the cells were incubated with a ryanodine receptor monoclonal antibody (C333) (MA3-916, Invitrogen) overnight at 4°C ...
-
bioRxiv - Bioengineering 2024Quote: ... HUVEC samples were treated with an Fc receptor blocking reagent (1 test) (Thermo Fisher Scientific, Cat. # 14-9161-73) and incubated at 4°C for 15 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... The mouse monoclonal transferrin receptor antibody (H68.4; 1:200 dilution) and rabbit polyclonal Rab11 antibody (71-5300; 1:50 dilution) were from Invitrogen, while the mouse monoclonal antibody against LAMP-1 (H5G11 ...
-
bioRxiv - Plant Biology 2019Quote: ... The recombinant enzymes were probed using anti-V5-HRP conjugated antibody (Invitrogen), which was detected using an ECL Advance Western Blotting Detection Kit (Amersham ...
-
bioRxiv - Immunology 2021Quote: ... and recombinant proteins were purified using Ni-NTA agarose (Thermo Fisher Scientific), then buffer-exchanged into PBS and concentrated using Amicon Ultra centrifugal filters (MilliporeSigma) ...
-
bioRxiv - Genomics 2020Quote: ... Recombinant BUD13 purification was confirmed by SimplyBue SafeStain (Thermo Fisher Scientific, LC6060) and western blot using BUD13 antibody (Bethyl Laboratories ...
-
bioRxiv - Immunology 2021Quote: All recombinant proteins were expressed and purified using Expi293F cells (Life Technologies,) as described in detail previously [34 ...
-
bioRxiv - Immunology 2019Quote: ... slices were overlaid with 50ng recombinant IL-15/IL-15Rαcomplex (Thermo Fisher) in 10□1 of cRPMI following peptide treatment ...
-
bioRxiv - Biochemistry 2019Quote: ... Recombinant virus was made by co-transfection into SF9 insect cells (Invitrogen) of the plasmid and BacVector3000 baculovirus DNA (Novagen ...
-
bioRxiv - Molecular Biology 2019Quote: ... and 2) 1 U/μL RNaseOUT™ Recombinant Ribonuclease Inhibitor (ThermoFisher Scientific). Hydra polyps in MCB buffer were homogenized on ice using a Dounce homogenizer ...
-
bioRxiv - Immunology 2019Quote: ... recombinant macrophage colony-stimulating factor (100 U/ml; ebioscience, Thermo Fisher Scientific) and Pen Strep (1:100 dilution ...
-
bioRxiv - Cell Biology 2019Quote: ... 20 ng/ml recombinant mouse macrophage colony-stimulating factor (Gibco, Burlington, ON), and penicillin/streptomycin antibiotics ...
-
bioRxiv - Microbiology 2020Quote: ... The recombinant plasmid was linearized using the Ncol restriction enzyme (ThermoFisher Scientific) and the MEGAscript® T7 Kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... and 20 U/ml recombinant interleukin-2 (IL-2; Thermo Fisher Scientific) at 37° C ...
-
bioRxiv - Molecular Biology 2021Quote: ... The guide RNAs and recombinant Cas9-NLS protein (Thermo Fisher Scientific, B25642) were transfected into HEK293 T-Rex cells with Lipofectamine CRISPRMAX Cas9 Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: Recombinant baculovirus was generated using the Bac-to-Bac expression system (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... The yield of the recombinant protein was estimated by Qubit 2.0 (Invitrogen) and the degree of purification by SDS-PAGE analysis.
-
bioRxiv - Cell Biology 2020Quote: HESCs were routinely maintained on recombinant VTN-N Vitronectin (A14700, Life Technologies), also tested on the prototype CTS™ (Cell Therapy Systems ...
-
bioRxiv - Immunology 2022Quote: ... media was additionally supplemented with recombinant murine IL-12p70 (Thermo Fisher Scientific) and recombinant murine IL-18 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... resuspended in water and pre-cleared with recombinant protein G agarose (Invitrogen). Immunoprecipitation of lysates was performed after lysis in NP-40 lysis buffer ...