Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 10000+ citations for Recombinant Human KLRD1 protein His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: L6 rat myoblasts expressing myc-tagged GLUT4 (33) were maintained in α-MEM (12561056, Gibco) supplemented with 10% fetal bovine serum and 1% pen/strep antibiotic in a humidified atmosphere containing 5% CO2 and 95% air at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... or ALS-associated Ruby-tagged sequences of DnaJC7 using 5 μL of Lipofectamine 2000 (Gibco) transfection reagent in OptiMEM (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... GFP-tagged cDNA constructs and siRNAs were transiently transfected using the Lipofectamine 3000 (Invitrogen, #L3000001) as per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: Purified RRMs were fluorescently tagged using Alexa Fluor™ 633 C5 Maleimide (Thermo Fisher Scientific). The dye was added to a sample of purified protein (1:10 protein:dye molar ratio ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotin-tagged ends were pulled down using Dynabeads MyOne Streptavidin C1 (Thermo Fisher Scientific 65001). Standard Illumina library preparation protocol including end repair ...
-
bioRxiv - Cell Biology 2023Quote: Genomic DNA was isolated from clonal CRISPR tagged cells using Genomic DNA Mini Kit (Invitrogen) according to manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2024Quote: ... Vectors of sulfatase 1 and 2 tagged with myc were transfected using Lipofectamine 2000 (ThermoFisher) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Biotin-tagged peptides were labeled with Pierce™ High Sensitivity NeutrAvidin™-HRP (Thermo Fisher) directly after blocking ...
-
bioRxiv - Genomics 2020Quote: ... SEMA3C protein levels were checked by western blot as described above using rabbit anti-human SEMA3C antibody (1:1000, Thermo Fisher Scientific). Beta-actin (housekeeping gene ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Colorimetric protein assays were conducted using commercial human IL-8 ELISA and mouse IL-6 ELISA kits (Invitrogen; 88-8086, 88-7064) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: Raw MS Data were searched against the human SwissProt protein database (Version November 2020) with Proteome Discoverer 2.4 (ThermoFisher Scientific, Bremen, Germany) using the following parameters ...
-
bioRxiv - Molecular Biology 2021Quote: ... HeLa cells in 35-mm dishes were transfected with 100 pmol of each siRNA in the Stealth siRNA library targeting 154 human nuclear proteins (Invitrogen–Thermo Fisher Scientific) using Lipofectamine RNAiMax (Invitrogen–Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... operated by UNICORN software version 5.11 (Build 407) using HiTrap Protein A columns (Cytiva) for full length human mAbs and CaptureSelect CH1-XL MiniChrom columns (Thermo Fisher Scientific) for Fab fragments ...
-
bioRxiv - Cell Biology 2022Quote: ... Click-iT™ HPG Alexa Fluor™ 488 Protein Synthesis Assay Kit (#C10428) and 1-Step Human Coupled IVT Kit – DNA (#88882) were obtained from Thermo Fisher Scientific Inc. ...
-
bioRxiv - Immunology 2022Quote: ... All S constructs were verified by Sanger sequencing and the protein was subsequently produced in human embryonic kidney (HEK) 293F cells (Thermo Fisher Scientific) and purified as previously described (4 ...
-
bioRxiv - Neuroscience 2022Quote: ... similarly as described previously.[60] MS data were analyzed using an in-house maintained human protein sequence databases using SEQUESTTM and Proteome DiscovererTM (Thermo Fisher Scientific). The mass tolerances of a fragment ion and a parent ion were set as 0.5 Da and 10 ppm ...
-
bioRxiv - Immunology 2023Quote: Plasmids coding for the soluble S ectodomain proteins as well as the RBD of human coronaviruses were transfected into Freestyle293F cells (Thermo Fisher R79007). Per 1 L of Freestyle 293F cells ...
-
bioRxiv - Neuroscience 2023Quote: ... Human brain tissue was homogenised with a Dounce homogeniser and placed in a low protein binding 15mL tube (Thermo Fisher Scientific, 30122216) containing 10mL 1X artificial CSF (pH 7.4 ...
-
bioRxiv - Immunology 2024Quote: ... tagged with human IgG Fc was transiently transfected using FreeStyle 293-F cells and purified using Protein G Plus Agarose (Pierce Thermo Fisher Scientific). RBD-SD1 was cleaved from the Fc by incubation with 3C protease (produced in-house ...
-
bioRxiv - Cancer Biology 2021Quote: ... human BNIP3 (Hs00969291_m1) and human 18S (Hs99999901_s1) were purchased from Applied Biosystems. 18S served as an internal control ...
-
bioRxiv - Microbiology 2022Quote: Human monoclonal antibodies were produced recombinantly in human Expi293F cells (Life Technologies) as described before (83) ...
-
bioRxiv - Cell Biology 2020Quote: ... Ki-67 recombinant rabbit monoclonal antibody (SP6) (Thermofisher, Cat. #: MA5-14520), Goat anti-Mouse IgG (H+L ...
-
bioRxiv - Microbiology 2022Quote: ... Recombinant soluble ACE2 was coated on NUNC Maxisorp plates (Thermo Scientific) at 1µg/well at RT for 3 h ...
-
bioRxiv - Biochemistry 2019Quote: ... The recombinant gene was cloned into pFastBac1 expression vector (Life Technologies) for bacmid production ...
-
bioRxiv - Cell Biology 2019Quote: Recombinant Bax was labeled by NBD dye (IANBD amide, Life Technologies) as reported previously (Kale et al. ...
-
bioRxiv - Genetics 2021Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Biochemistry 2021Quote: ... the isolated recombinant EMBacY was transfected into adhesive Sf9 cells (Invitrogen) in 6-well plates ...
-
bioRxiv - Biophysics 2022Quote: ... and 2 ng/mL recombinant murine interleukin-3 (IL-3) (Gibco). Cells were grown in a humidified incubator at 37 °C and 6% atmospheric CO2 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 U of recombinant Taq DNA Polymerase (Thermo Fisher Scientific, Lithuania) and water to final volume of 10μl ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and incubated on ice for 10 minutes ...
-
bioRxiv - Neuroscience 2020Quote: ... We used GFP recombinant rabbit monoclonal antibody (G10362, Thermo Fisher Scientific) at 1:300 dilution and monoclonal anti-GFP ...
-
bioRxiv - Immunology 2021Quote: ... and 1µl of RNaseOUTTM Recombinant Ribonuclease Inhibitor (Invitrogen, Catalogue no.-10777019). 11µl of the cocktail was added to the RNA/primer mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... and RNaseOUT™ Recombinant Ribonuclease Inhibitor (Thermo Fisher, Cat. No. 10777019) and the lysates were incubated on ice for 10 minutes ...
-
bioRxiv - Bioengineering 2020Quote: ... then treated with recombinant DNaseI (DNA-free DNA removal kit, Ambion) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... Recombinant soluble DPP4 was coated on NUNC Maxisorp plates (Thermo Scientific) at 100 ng/well at RT for 3 h ...
-
bioRxiv - Microbiology 2021Quote: ... Reactions were performed using Taq DNA Polymerase Recombinant kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Recombinant mAbs were then produced in EXPi293F cells (Life Technologies, USA) by transfecting pairs of the IgG1 heavy and light chain expression plasmids ...
-
bioRxiv - Microbiology 2022Quote: ... The full Delta-Omicron recombinant spike was cloned into pcDNA6 (Invitrogen). Point mutations were introduced by overlap extension PCR ...
-
bioRxiv - Cell Biology 2022Quote: ... 10 ng/ml mouse recombinant LIF (ES cell-tested) (Gibco #A35935). Upon reaching confluence ...
-
bioRxiv - Molecular Biology 2023Quote: All PCRs were performed by using Recombinant Taq polymerase (Thermo Scientific). 100 ng of the synthesized DNA was mixed with 1X PCR buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... or 20mg/mL proteinase K (recombinant PCR grade, ThermoFisher Cat# EO0492) for 10 ...
-
bioRxiv - Neuroscience 2022Quote: ... and recombinant rabbit monoclonal anti-LUM (Lumican, Invitrogen Cat#MA5-29402). The samples were subsequently digitized using a NanoZoomer Hamamatsu S60 digital slide scanner.
-
bioRxiv - Immunology 2023Quote: Recombinant gp120s were produced via transient transfection using Freestyle 293F (ThermoFisher) or 293S GnT1- cells and 293Fectin using the same conditions as SOSIP gp140s ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Immunology 2023Quote: ... TotAZsk6 embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting TotX coding sequence (GTTCAAGTTATGAGGAACACAGG) ...
-
bioRxiv - Neuroscience 2023Quote: ... 200 units/ml RNaseOUT Recombinant Ribonuclease Inhibitor (#10777019; Thermo Fisher Scientific); 0.5 mm Spermidine (#S2626 ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Immunology 2023Quote: Recombinant mAbs were transiently produced in FreeStyle 293F cells (ThermoFisher Scientific) following the protocol detailed by Vink et al (Vink ...
-
bioRxiv - Genetics 2023Quote: ... 50 ng/ml recombinant mouse epidermal growth factor (EGF; Gibco, PMG8041), 100 ng/ml recombinant murine Noggin (PeproTech ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1% penicillin/streptomycin and 50ng/ml recombinant mouse EGF (Life Technologies) was used for culturing ApcKO colon organoids ...