Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 10000+ citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... and 3% O2 in RPMI (Life Technologies) supplemented with 20mM HEPES (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 3-8% NuPage gels (Invitrogen, EA03785BOX) to probe for high molecular weight proteins ...
-
bioRxiv - Molecular Biology 2024Quote: ... RNA 3′-ends were dephosphorylated (PNK [ThermoFisher] in buffer containing 350 mM Tris-HCl pH 6.5 ...
-
bioRxiv - Microbiology 2024Quote: ... or 3) placed in TRIzol (ThermoFisher, #15596026) for viral load assessments ...
-
bioRxiv - Microbiology 2024Quote: ... 3 µg/mL of puromycin (Thermo Fisher) was added as appropriate ...
-
bioRxiv - Microbiology 2024Quote: ... 3 g/L trisodium citrate (Fisher Scientific), 2 g/L KCl (Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 μL NuPAGE LDS sample buffer (Invitrogen) (92 μL stock diluted in 8 μL 2-Mercaptoethanol ...
-
bioRxiv - Microbiology 2024Quote: ... 3 pulse using Neon electroporation system (Invitrogen). After 6 h of transfection ...
-
bioRxiv - Immunology 2024Quote: ... and 3% fetal calf serum (FCS) (Invitrogen)) for 30 min at 37°C before mechanical disruption through a 100 μm filter on ice ...
-
bioRxiv - Immunology 2024Quote: ... and 3 mM MgCl2 (Invitrogen™, AM9530G) in Nuclease-Free Water (QIAGEN ...
-
bioRxiv - Microbiology 2024Quote: ... Kindlin-3 (Thermo Fisher Scientific, #PA5-30847), Myeloperoxidase (abcam ...
-
bioRxiv - Cell Biology 2024Quote: ... on a QuantStudio 3 (Applied Biosystems, USA). Relative expression was calculated for each gene by the 2-△△CT method ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 3 ml Optimem medium (Gibco, 31985062). After 48 hours of incubation ...
-
bioRxiv - Plant Biology 2024Quote: ... 3 µl GlycoBlue (AM9516, Thermo Fisher Scientific), and 400 µl isopropanol were added to the resulting supernatant for incubation at −30°C for 60 min to precipitate the RNAs ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... using QuantStudio® 3 (Applied Biosystems, USA). Expression levels were normalized to the values for Actb ...
-
bioRxiv - Microbiology 2024Quote: ... QuantStudio 3 (Thermo Fisher Scientific, Tokyo, Japan) was used for the assay ...
-
bioRxiv - Immunology 2024Quote: ... On day 3 cells were trypsinized (ThermoFisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... and Tris-Acetate gels (Invitrogen, 3-8%). MOPS buffer (Invitrogen Life Technologies ...
-
bioRxiv - Molecular Biology 2024Quote: ... on a QuantStudio 3 system (Applied Biosystems). The qRT-PCR conditions were 55°C for 10 min ...
-
bioRxiv - Biochemistry 2024Quote: ... A QuantStudio 3 RT-PCR thermocycler (Invitrogen) was used to initially cool to 5°C at a rate of 1.6 °C/s ...
-
bioRxiv - Bioengineering 2024Quote: ... fluorescent labeling of nuclei (TOPRO-3, Thermofisher) and F-actin filaments (Alexa Fluor 488 phalloidin ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μΜ nocodazole (Thermo Fisher Scientific, AC358240100), 2.5 or 5 μΜ STLC (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2024Quote: ... 3-8% Tris-Acetate gel (ThermoFisher #EA0375BOX) and 1X MES SDS Running buffer (ThermoFisher #NP0002 ...
-
bioRxiv - Developmental Biology 2024Quote: ... FluoZin-3 (20 µM; F24194, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion, USA #4390824); Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab11a - 5’-CAACAAUGUGGUUCCUAUUtt-3’ (Ambion, USA #4390824); Rab11b - 5’-CUAACGUAGAGGAAGCAUUtt-3’ (Ambion ...
-
bioRxiv - Cell Biology 2024Quote: ... Rab35 - 5’-GCAGUUUACUGUUGCGUUUtt-3’ (Ambion, USA #4390824). The transfection of single siRNA or a combination of different siRNAs and the rescue of siRNA-treated cells with co-transfection of plasmid DNA and siRNA were completed according to the manufacturer’s (Invitrogen ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were washed 3 times for 10 minutes per wash in PBS before incubation in secondary antibody Alexafluor 488 Goat-anti-rabbit (Thermo Fisher 150077; [1:500]; Waltham, MA) diluted in probing solution for 2 hours at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... The wells were washed 3 times with 1 mL PBS 1X and covered with a mixture containing secondary goat anti-rabbit-Alexa488 antibodies (Invitrogen Molecular Probe 2mg.mL-1, 1/300e) and DAPI (1/100e ...
-
bioRxiv - Immunology 2022Quote: ... after which cells were permeabilised (0.1% Triton X100) and stained with an antibody recognising dengue virus envelope protein (Invitrogen MA1-27093, for DENV serotypes 1-3), pan flavivirus envelope (Millipore MAB10216 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Knockdown of the protein was monitored by western blotting against the V5×3 epitope using α-V5 mouse primary antibody (Invitrogen / Thermo Fisher Scientific – 1:1000). Oligonucleotides used for PCR amplification are given in Table S4.
-
bioRxiv - Cell Biology 2024Quote: ... slides were washed in PBS 3×5 minutes and then stained with the secondary antibody Goat anti-rabbit AlexaFluor555 (Invitrogen #A21429, working concentration 2 µg/µl) or Goat anti-rat Alexa488 (Thermofisher #A-11006 ...
-
bioRxiv - Plant Biology 2022Quote: ... nitrogen and the stable isotope ratios of these elements were determined on Thermo Scientific Delta V+ IsoLink IRMS System (Thermo Fisher Scientific Inc., Waltham, MA, USA) at the Stable Isotope Lab of Lamont-Doherty Earth Observatory (Palisades ...
-
bioRxiv - Plant Biology 2022Quote: ... The amount of total foliar nitrogen and carbon (Ntotal and Ctotal, respectively) in dry leaves was measured using an organic element analyzer (Flash EA 112, Thermo Fisher Scientific Inc., Waltham, MA, USA). The cellular composition was obtained after the neutral detergent fiber (NDF ...
-
bioRxiv - Cell Biology 2020Quote: ... Endoplasmic reticulum (ER) was labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, aka DiIC18(3)) (Thermo Fisher #D282) or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2020Quote: Caspase-3-like activity was quantified using the EnzChek Caspase-3 Assay kit #1 (Molecular Probes, Eugene, OR, USA). Tissue samples were thawed on ice for 5 min ...
-
bioRxiv - Biochemistry 2020Quote: Cultivated Jurkat cells were collected and washed 3 times in flow buffer (PBS without Ca/Mg, 3% FBS, Gibco). Cell concentration was measured ...
-
bioRxiv - Cancer Biology 2020Quote: ... TIC-enriching 3-D cultures (3-D) were maintained in stem cell media: DMEM:F12 (+ L-glutamine, + 15 mM HEPES) (Gibco) supplemented with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reactions were run on the QuantStudio 3 and analyzed on the QuantStudio 3 Design and Analysis software v1.5.1 (ThermoFisher Scientific). Quantitation and normalization of relative gene expression were accomplished using comparative threshold cycle method or ΔΔCT.
-
bioRxiv - Cell Biology 2021Quote: Total RNA from control (n=3) and model (n=3) Huh7 cells were isolated by TRIZOL reagent (Thermo Scientific), and the RNA concentration ...
-
bioRxiv - Cell Biology 2022Quote: ... TcBDF2W92AFw (5’CGACTCCGCTGCGGTTAAAG-3’) and TcBDF2W92ARv (5’-CTTTAACCGCAGCGGAGTCG-3’).The PCR products were first cloned into the pCR2.1-TOPO vector (Invitrogen) and sequenced ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then lysed and a caspase-3 assay was performed according to the manufacturer’s protocol (EnzChek caspase-3 Assay, Invitrogen). The intensity of fluorescence was analyzed using an EnVizion plate reader.
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Developmental Biology 2020Quote: RNA from Rbx2 fl/fl (n=3) and Rbx2cKO-Nes (n=3) P1 telencephalons was extracted using TRIzol (Invitrogen). Strand-specific and barcode-indexed RNA-seq libraries were generated from 1 μg total RNA each after poly-A enrichment using the Kapa Stranded mRNA-seq kit (KapaBiosystems ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Immunology 2020Quote: 3’ RACE analysis was performed on testis and liver RNA using the 3’ RACE System kit (Thermo Fisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Detection of active caspase 3/7 was accomplished using CellEvent™ Caspase-3/7 Red Detection Reagent (ThermoFisher Scientific). Sorted CD4SP Rag1GFP+ thymocytes were stained with CD5-PerCP-Cy5.5 (53-7.3 ...