Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 10000+ citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... one or two guanines were added to the 5’ end of the guide sequence within the primer to ensure the format “5’-GG(N18-20)-3’” in order to facilitate in vitro transcription with MEGAscript T7 in vitro transcription kit (Ambion). Transcribed sgRNAs were purified with MEGAclear kit (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: RNA from individual E10.5 hearts (N=3 or 5 per genotype) was isolated using the RNAqueous-Micro Total RNA Isolation Kit following manufacturer recommended protocols (Invitrogen). cDNA synthesis was performed using random hexamers and SuperScript IV reverse transcriptase (Invitrogen) ...
-
bioRxiv - Genomics 2021Quote: ... 10 µg of antibody (3 µg for H3K27ac) was added to 5 µg of sonicated chromatin along with Dynabeads Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged for 3 mins at 300 x g and resuspended in 5 mL of 5x TrypLE (Cat.No. A1217701; Thermo Fisher) in L15 and incubated on an orbital rotator at room temperature for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... 4 million cells per sample were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... HGrC1 cells (15 samples including 3 replicates for 5 conditions) were lysed using TRIzol reagent (catalog #15596026, Thermo Fisher Scientific) and RNA was extracted with Direct-zol RNA MiniPrep kit (#R2052 ...
-
bioRxiv - Immunology 2021Quote: ... 4 million isolated splenocytes or inguinal lymph node cells were stimulated ex vivo for 3 hours at 5% CO2 at 37°C in Minimum Essential Media (Gibco) containing 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... Qβ-VLPs were then re-packaged with B-type 1668 CpGs (5″-TCC ATG ACG TTC CTG ATG CT-3″) with phosphorothioate backbone purchased from (InvitroGen). The re-packaging was confirmed by 1% agarose gel stained with SYBR Safe dye for 30min at 90V ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μL (10μM) reverse primer (ldh4_R, 5’-AATCACAGCAGCCCCTTG-3’) and 1 μL (1 U/μL) Platinum Taq DNA polymerase (Invitrogen, 10966-018) in a 50 μL total reaction volume ...
-
bioRxiv - Developmental Biology 2022Quote: ... 10 µg of antibody (3 µg for H3K27ac) was added to 5 µg of sonicated chromatin along with Dynabeads Protein A magnetic beads (Invitrogen) and incubated at 4 °C overnight ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were then washed 3 times for 5 minutes each with PBS and mounted using ProLong Diamond anti-fade mountant with DAPI (Invitrogen) and allowed to cure overnight ...
-
bioRxiv - Cell Biology 2022Quote: ... 5′-CCUGGAUAAUGAUGAAGGA-3′), OSBP (predesigned, cat. no. 4392420) and nontargeting control siRNA (predesigned, cat. no. 4390844) were purchased from Ambion. ON-TARGET plus Human PI4K2A siRNA (predesigned ...
-
bioRxiv - Cell Biology 2022Quote: ... All samples were boiled for 5 min prior to separation by SDS PAGE on precast 3-8% Tris-Acetate NuPAGE gels (Invitrogen). SDS-PAGE fractionated proteins were transferred to a nitrocellulose membrane using a semidry Trans-Blot Turbo Transfer System (Bio-rad) ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Physiology 2022Quote: ... R:3’-UUGAACGUCACUAUAUUAACUGUUGUA-5’) dicer-substrate siRNA (DsiRNA) (20 nM, Integrated DNA Technologies, Coralville, IA) using Lipofectamine 3000 transfection reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... Tenfold dilutions were used to infect confluent Vero E6 cells in a 96-well plate in MEM (5% FBS, 1% penicillin-streptomycin, 1% kanamycin, 3% amphotericin B (Gibco)) at 37°C and 5% CO2 ...
-
bioRxiv - Biophysics 2024Quote: ... Individual reactions were heated to 65 °C for 5 min and transferred to ice for 3 min to facilitate annealing in SuperScript III reaction buffer (Invitrogen). After annealing ...
-
bioRxiv - Cell Biology 2023Quote: Sac2 knockdown was performed with siRNA targeting mouse gene sequence Inpp5f: 5’-GGAAUGCGGUAUAAACGAATT-3’ and was from Ambion (Life Technologies). OSBP knockdown was performed using ON-TARGET plus SMART pool Mouse OSBP siRNA from Dharmacon ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Neuroscience 2024Quote: ... The following day the sections were washed 3 times for 5 min each in PBS-T and incubated with the corresponding secondary antibodies (all 1:1000, Invitrogen), for 2 h at room temperature ...
-
bioRxiv - Microbiology 2024Quote: ... 20% PE: 5% PS) were prepared as described in (49) with the addition of DiOC18(3) (3,3’-Dioctadecyloxacarbocyanine Perchlorate) (Invitrogen, D275) for fluorescence ...
-
bioRxiv - Neuroscience 2024Quote: ... Samples were rinsed 3 x 5 minutes with 1X PBS before mounting with Fluoromount G (Fisher Scientific; 50-259-73).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then washed 3× for 5 min each in PB and mounted with Prolong Gold (Thermo Fisher cat#P36930) and Deckglaser cover glass (Fisher Scientific cat#NC1776158) ...
-
bioRxiv - Molecular Biology 2023Quote: ... The grids were blotted for 3-5 s at 15-22 °C and 100% humidity in a Vitrobot Mark IV (ThermoFisher Scientific Inc. ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were grown in 24 -well plates to ∼60% confluency and transfected with small interfering RNA specific to TRPM2 (TRPM2-siRNA, 5′-GAAAGAAUGCGUGUAUUUUGUAA-3′, custom-made by Dharmacon) or scrambled control siRNA (Scr-siRNA: 4390846, Ambion) in Opti-MEMTM using 25 nM siRNA and 1 ul of Lipofectamine® RNAiMAX28 ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1μl of oligo-dT30VN primer (10 μM 5’-aagcagtggttatcaacgcagagtact30vn-3’) and 1 μl of 10 mM dNTP mix (Thermo Fisher). Illumina libraries were prepared by using a modified smart-seq2 protocol [Picelli 2014] using SuperScript IV RT and tagmentation procedure as previously described [Henning 2018] ...
-
bioRxiv - Bioengineering 2023Quote: ... The fixed cells were then washed with 0.1% Triton X-100 in PBS solution for 3 times with 5 min each and incubated with Goat anti-rabbit 488 nm (Thermofisher Scientific Cat# A-11008 ...
-
bioRxiv - Bioengineering 2024Quote: ... PCR primers (F primer 5’ agatcagatctttgtcgatcctacca 3’ and R primer 5’tcatctcccggggttgtggc 3’) were used to amplify the entire first cistron and IRES using Accuprime Pfx (Invitrogen) for 30 cycles ...
-
bioRxiv - Cell Biology 2024Quote: ... On the day of electroporation organoids were dissociated into small clumps of 3-5 cells using mechanical pipetting and TrypLE incubation and resuspended in Opti-MEM Reduced Serum Medium (Gibco). 5 μg of the cloned REG1A sgRNA-plasmid ...
-
bioRxiv - Zoology 2023Quote: ... the sections were again washed with TBS (3 times; 5 min each) and mounted in Fluromount-G mounting media with DAPI (004959-52, Invitrogen). The dried slides were visualized using Leica DM4000B fluorescence microscope equipped with Leica DFC310 FX camera ...
-
bioRxiv - Neuroscience 2023Quote: ... washed in PBS (3 x 5 min) mounted on glass slides (SuperFrost Plus Microscope Slides, ThermoFisher Scientific, Waltham, MA, USA) and left to air-dry overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Coverslips were then washed 3 x for 5 min with 1x PBS before mounting onto glass slides using ProLong Diamond Antifade mountant (Invitrogen) and left to dry for 24 hr at 4°C before imaging ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Cell Biology 2023Quote: ... Slides were washed in 3 baths of PBS for 5 min each and mounted in Prolong Gold (Invitrogen Cat. #P36934) with a glass coverslip applied over the tissue sections ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were then washed for 3×5 minutes in PBT and mounted on a slide in a drop (∼40 µL) of SlowFade Diamond antifade (Invitrogen), covered in a 22×50 mm #1.5 coverslip sealed with nail polish ...
-
bioRxiv - Molecular Biology 2023Quote: ... Clones 3 and 5 were transduced with Lenti-rtTA-P2A-Blast viruses and selected in 10 ug/mL Blasticidin (Invitrogen) for 7 days ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Microbiology 2023Quote: ... /AgeI-Reverse (5’-AAGTTTAAGCACGTACCGGTACGC-3’) containing the desired mutation were used to amplify two PCR products using AccuPrime Taq (Invitrogen). The amplicons were digested with either XmaI or AgeI restriction enzymes (New England Biolabs) ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE-1 cells or MiniBAR-GFP stable cell lines were transfected with 25 nM of siRNAs targeting either luciferase or human Mini-BAR (5’-CUGCAAAUUUUACGGAUCA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... or 5’-TCAAGGTCCCTGATAATTATGGCGA-3’) or scrambled siRNA (non-targeting control) using 6 μL Lipofectamine™ RNAiMAX (Invitrogen™ - Cat.# 13778075). After 24 h ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were cultured for 3 days under cold-shock conditions (32 °C/5% CO2) and in the presence of RevitaCell (ThermoFisher) and HDR enhancer (1 µM Alt-R HDR Enhancer v2 ...
-
bioRxiv - Neuroscience 2023Quote: ... BDNF_R: 5’-GCACTTGGTCTCGTAGAAGTA-3’) designed with the web-based software Primer3 and Syber Green PCR Master mix (Applied Biosystems, US). While ...
-
bioRxiv - Molecular Biology 2023Quote: Total RNA was extracted in quadruplicate from male L3 larvae and 3-5 day old adults of the indicated genotypes and experimental groups using standard Trizol (ThermoFisher) extraction ...
-
bioRxiv - Molecular Biology 2023Quote: ... The rRNA-depleted small RNA samples were subsequently subjected to FastAP/PNK treatment to remove RNA 5’ and 3’ phosphates by incubating samples with 2.5 μl 10x FastAP Buffer (Thermo Fisher), 0.5 μl RNaseOUT (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: Adult females were collected and fed for 3-5 days before ovaries were dissected and fixed in 5.14% formaldehyde (Pierce, ThermoFisher Scientific) in phosphate buffered saline (PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... pME-Dmist was recombined with 5’ (p5E-CMV/SP6) and 3’ (p3E-GFPpA) entry clones and destination vector (pDestTol2pA2) using Gateway Technology (Invitrogen LR Clonase II Plus enzyme Cat No ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The supernatant was clarified and resuspended in PBS (3 mM EDTA) with 5 μg/mL Hoechst (33342 Thermo Fisher Scientific) and incubate 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... The membrane was washed 3 times with 5% milk TBST and incubated with HRP-conjugated secondary antibodies (1:5000, 32230/32260; Invitrogen). Data were visualized using chemiluminescence detection on ChemiDoc Touch (Bio-Rad Laboratories).
-
bioRxiv - Immunology 2023Quote: ... and probe 5’-FAM-TCCAGCCTCCATAGCCGGGAAGG-TAMRA-3’ were used in a 25μL reaction with Supermix Platinum™ Quantitative PCR SuperMix-UDG (Invitrogen). The reaction was performed in a 96-well format for real time quantification on Applied Biosystems 7900HT Fast Real-Time PCR System ...