Labshake search
Citations for Thermo Fisher :
1801 - 1850 of 10000+ citations for 3 Ethyl 3 methyloxolane 2 5 dione since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... retinas were incubated with secondary antibodies at 4°C for another 2-3 days: goat anti-chicken antibody conjugated to Alexa Fluor 488 (1:1000; A11039, Invitrogen), goat anti-rabbit 555 (1:1000 ...
-
bioRxiv - Immunology 2024Quote: ... and 3 µg/mL (full dose, or diluted to 1/2, 1/4, 1/8) anti-CD28 (MA110172, Thermo Fisher), and cultured in the pre-coated plate for 3 days ...
-
bioRxiv - Bioengineering 2024Quote: ... 2.08 x 102 ng/cm2 of pDNA was mixed with the 2 μL p3000 reagent per μg DNA then combined with 3 μL/μg Lipofectamine 3000 (Invitrogen) and incubated for 15 minutes before adding over cells ...
-
bioRxiv - Immunology 2024Quote: ... the samples were rinsed with PBS 2-3 times and mounted with ProLong Gold antifade reagent containing DAPI (Life Technologies). The samples were then visualized using a Zeiss LSM 880 Confocal Laser Scanning Microscope ...
-
bioRxiv - Developmental Biology 2024Quote: ... Slides were then incubated for 1 hour in 2-3 drops per slide of HRP-conjugated streptavidin (Alexa Fluor 594 Tyramide Superboost Kit, Invitrogen), washed 3 times for 10 minutes each in 1x PBS ...
-
bioRxiv - Biochemistry 2024Quote: ... the final transfection mixture contained 3 μL of lipofectamine with 2 μg of total plasmid DNA in 200 μL OptiMEM (31985070, Gibco). The transfection mix was incubated for 20 min at room temperature before adding to seeded HEK cells (confluency ∼ 60-70% ...
-
bioRxiv - Bioengineering 2024Quote: ... and primers (Eurofins Scientific, France) at the specified melting temperature (Tm) (Table 2) using a QuantStudio 3 (Thermo Fisher Scientific) thermocycler ...
-
bioRxiv - Biochemistry 2024Quote: ... the degree of labelling was compared to hydrolysed succinimidyl 3-(2-pyridyldithio)propionate (SPDP, 0.3 kDa vs. 2.7 kDa, ThermoFisher, UK, #21857). To appraise the percentage labelling the fluorescent signals from the chased samples were calibrated against F-MAL standards ...
-
bioRxiv - Cell Biology 2022Quote: ... ethyl ester (TMRE, final concentration 20nM, Life Technologies) in the relevant medium for 10 min and analyzed by confocal microscopy (Takashima et al. ...
-
bioRxiv - Immunology 2020Quote: ... and ethyl ether were purchased from Fisher Scientific. Peptides were synthesized using automated Fmoc SPPS chemistry (Syro I) ...
-
bioRxiv - Microbiology 2023Quote: Ethyl acetate (EtOAc; J.T. Baker and Fisher Scientific) and Optima-grade methanol (MeOH ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetramethylrhodamine ethyl ester (TMRE) was purchased from ThermoFisher; catalog no.T669.
-
bioRxiv - Immunology 2024Quote: ... 100nM Tetramethylrhodamine ethyl ester (TMRE) (#T669, ThermoFisher Scientific) MFI was used as a measure of actively metabolizing mitochondria.
-
bioRxiv - Biochemistry 2024Quote: ... 100 mM N-ethyl maleimide (NEM) (Thermo Scientific) was added and the mixture was further incubated for 10 min ...
-
bioRxiv - Cell Biology 2020Quote: MiaPaCa-2 cells were seeded in 12-well plates and transfected with 3 µg of DNA (NUPR1-GFP, NUPR1-Flag or control vector) and 3 μL of Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific) per well ...
-
bioRxiv - Developmental Biology 2021Quote: ... were transfected with pPyCAG-(HA)3-Nanog-IRES-Puro and pPyCAG-(Flag)3-Resf1-IRES-Puro using Lipofectamine 3000 (Invitrogen cat. L3000001). In parallel ...
-
bioRxiv - Neuroscience 2021Quote: All females were ovariectomized and primed for 3 days with subcutaneous administration of estradiol benzoate (17-β-Estradiol-3-Benzoate, Fisher Scientific, 2 μg dissolved in sesame oil starting 3 days prior to experiments) ...
-
bioRxiv - Biochemistry 2022Quote: ... was mixed with 10 nm gold nanoparticles and was applied to the glow discharged surface and blotted at 4 °C and 100% relative humidity for 3 s and a blot force of −3 using the Vitrobot IV System (Thermo Fisher Scientific). Grids were plunged in 100% liquid ethane ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary neurospheres grown for 3 days (3-4 million cells) were harvested and crosslinked with 0.5% formaldehyde (Thermo Fisher, cat. no. 28908) in 0.1 M DPBS for 5 min at RT with soft agitation ...
-
bioRxiv - Cell Biology 2022Quote: ... The C2C12 cells were transfected with 2 μg plasmids (L-Cas9n-EGFP:R-Cas9n-puro=3:1) by electroporation (1650 v/10 ms/3 pulses) with the Neon Transfection System Kit (Thermo Fisher Scientific). The cells were seeded overnight to 24-well plates containing an antibiotic-free complete mediums ...
-
bioRxiv - Genetics 2021Quote: ... SDS-Page separation was completed by running between 3 and 10μg of total protein on a NuPAGE 3%–8% Tris-acetate gel (Thermo Fisher Scientific Scientific). Next ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Molecular Biology 2023Quote: ... The following day the miR-423-5p or miR-Ctrl vector was cotransfected with either the Cacna2d2-3’UTR or the Cacna2d2 mut 3’UTR reporter vectors using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2024Quote: ... 2 µl cDNA was amplified with TaqMan™ qPCR (38 cycles, 3 technical replicates of 3 biological replicates) using master mix (Thermo Fisher) and the following TaqMan assays ...
-
bioRxiv - Microbiology 2024Quote: ... 1 μg of plasmid and 3 μL of Lipofectamine 2000 (m/v = 1:3) were diluted in 0.1 mL of Opti-MEM (Gibco, 31985070, Gaithersburg, MD). After 5 min of incubation ...
-
bioRxiv - Immunology 2024Quote: ... and SB28 RRV-IRF8 (100% transduced) cells were plated at 1x105 cells (n=3 per time point) and counted (Thermofisher Countess 3)at 24 and 48 hours post-seeding ...
-
bioRxiv - Biophysics 2024Quote: ... and N-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-propionyl)-1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (BODIPY FL DHPE) were purchased as solids from Invitrogen (Thermo Fischer Scientific), Avanti Polar Lipids ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 μl of sample was saved for 3′ -biotin labeling for visualization using Pierce RNA 3′ End Biotinylation Kit (Life Technologies 20160) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and 40 cycles of PCR (95°C for 3 seconds, 60°C for 30 seconds) on a QuantStudio 3 (Applied Biosystems, MA).
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Biochemistry 2023Quote: The ibpA 5’ UTR-gfp mRNA produced from CUGA®7 in vitro transcription kit (Nippon Gene) was attached to a 3’-terminal biotinylated nucleotide using Pierce™ RNA 3’ End Biotinylation kit (Thermo Scientific). The biotin-labeled mRNA (0.1 µM ...
-
bioRxiv - Physiology 2023Quote: ... Digitonin solubilized mitochondria were loaded 3-12% Bis-Tris Invitrogen™ Novex™ NativePAGE™ 3-12% acrylamide gel (1mm) (Invitrogen, BN2011BX10) using the anode running buffer (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... Four microliters of LotA7-544 was loaded onto a glow-discharged grid and blotted for 3 s with blot force 3 using Vitrobot Mark IV (Thermo Fisher, U.S.A.).
-
bioRxiv - Cell Biology 2023Quote: Supernatants of cell culture medium collected during medium exchanges were analysed for albumin (10242, Diagnostic Systems) and 3-beta-hydroxybutyrate (Autokit 3-HB, Fujifilm Wako) on an Indiko Plus chemical analyzer (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuron-cancer cocultures were quantified for neuronal outgrowth by identical image generation and processing with additional pre-incubation (3 drops/mL for 90 min at 37◦C) of NucRed Dead 647 ReadyProbes™ Reagent (TO-PRO-3 iodide) (Invitrogen, #R37113) for dead cells and NucBlue Live ReadyProbes™ Reagent (Hoechst 33342 ...
-
bioRxiv - Microbiology 2024Quote: Imaging of intracellular calcium levels and distribution was performed by Rhod 3 staining using the Rhod-3 Calcium Imaging Kit (Thermo Fisher Scientific) following the manufacturer’s protocol as described previously 14 ...
-
bioRxiv - Microbiology 2024Quote: ... Serum samples were assayed at 3-fold dilutions starting at a 1:3 dilution in Blocker Casein in PBS (Thermo Fisher Scientific) diluent ...
-
bioRxiv - Neuroscience 2024Quote: ... 10 µg of Pantr1 sense RNA were used to label the 3’ end using Pierce™ RNA 3’ End Desthiobiotinylation Kit (Thermo Scientific). After labelling ...
-
bioRxiv - Genomics 2024Quote: ... liver and muscle tissues from a total of 72 fish (n = 8 salmonid species x 3 biological replicates x 3 tissues) using TRIzol (Invitrogen/Life Technologies) with glass mill beads (1mm ...
-
bioRxiv - Genetics 2021Quote: ... The membrane was hybridized with a biotin-conjugated telomere probe (5’-biotin-CACACCCACACCCACACC-3’) and was imaged using a Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific) and a Li-Cor C-DiGit Chemiluminescent Western Blot scanner.
-
bioRxiv - Neuroscience 2021Quote: ... and Standard Control (5’ CCTCTTACCTCAGTTACAATTTATA 3’) MOs (GeneTools) were diluted in distilled water and co-injected with Cascade Blue labelled dextran (Molecular Probes) into one- to two-cell wild-type (Tübingen ...
-
bioRxiv - Neuroscience 2020Quote: ... The slides were then washed in 1X PBS 3 times for 5 minutes before being incubated with Hoechst 33342 (Thermo Fisher) for 5 minutes before being washed again and coverslipped with prolong diamond (Life Technologies) ...
-
bioRxiv - Neuroscience 2021Quote: ... we designed more than 2 pairs of PCR primers in the 5’ and 3’ untranslated regions and inserted all resulting PCR products into pCR-Blunt-TOPO vector (Thermo Fisher). The TOPO-transcript vectors of the same gene were sequenced and compared to verify that no error was introduced to the coding sequence during reverse transcription ...
-
bioRxiv - Molecular Biology 2021Quote: ... Both halves of MF filters and entire SF filters were transferred independently to 5 mL Eppendorf tubes and 3 mL of autoclaved PBS pH 7.4 (1X) (Gibco™, Thermo Fisher) was added ...
-
bioRxiv - Molecular Biology 2021Quote: ... a DNA oligo template (5’ TAATACGACTCACTATAGGGACACAAAACAAAAGACAAAAACACAAAACAAAAGACAAAAACA CAAAACAAAAGACAAAAAGCCTCTCCTTCTCTCTGCTTCTCTCTCGCTGTGTGCGTACAACTAGCT 3’) was PCR-amplified and then in vitro transcribed using the MEGAshortscript™ T7 Transcription kit (Invitrogen). An 11:7 ratio of the helicase RNA substrate to 5’ Alex Fluor 488 fluorescent oligo strand (Alexa Fluor 488/ AGCTAGTTGTACGCACAC ...
-
bioRxiv - Molecular Biology 2020Quote: ... We also sequentially removed the 5’ and 3’ viroid moieties from this latter plasmid via PCR with the phosphorylated primers (T4 polynucleotide kinase, Thermo Scientific) D3606 and D3285 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The MommeD43 mutation (A667E) was introduced by oligonucleotide-directed mutagenesis (5’ CTGTGCCCATTGAAAAGCTGGAT AGG; 3’ CCTATCCAGCTTTTCAATGGGCACAG) and ligated into the pFastBac Htb vector (Life Technologies). Bacmids were prepared using the Bac-to-Bac system ...
-
bioRxiv - Bioengineering 2022Quote: Primary neonatal cardiomyocytes were isolated from C57BL/6 mouse neonates on postnatal days 3-5 using the Pierce Primary Cardiomyocyte Isolation Kit (Thermo Fisher) as previously described (14) ...
-
bioRxiv - Genomics 2020Quote: ... cells were washed 3 times in 1xPBS for 5 minutes at room temperature and mounting was done in ProLong Gold with DAPI (Invitrogen, P36935). Images were collected on a LSM800 confocal microscope (Zeiss ...
-
bioRxiv - Genomics 2020Quote: ... 1,000,000 wild-type (J1) mESCs were transfected with 1µg of each 5’ and 3’ sgRNA-Cas9-mCherry plasmids using Lipofectamine 2000 (Thermo Fisher Scientific). After 24hrs of transfection ...