Labshake search
Citations for Thermo Fisher :
1601 - 1650 of 10000+ citations for 14 3 3 Rabbit Recombinant mAb since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... We then amplified and eif-3.G cDNA using primers for the SL1 trans-splice leader (YJ74) and eif-3.G isoform A 3′UTR (YJ11560) and Phusion polymerase (Thermo Fisher Scientific, San Diego, CA). The cDNA clones in PCR8 vector were then used to generate tissue-specific expression constructs using Gateway™ cloning destination vectors (pCZGY1091 for Punc-17β ...
-
bioRxiv - Plant Biology 2019Quote: Developing gemma cups located within 3 mm from an apical notch of 3-week-old thalli were manually dissected and immediately immersed in RNAlater (Thermo Fisher Scientific, Waltham, MA, USA). For the control ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Red cells were removed by incubating the splenocytes for 3 minutes with 3 ml eBioscience™ 1X RBC Lysis Buffer (Invitrogen, ThermoFisher, #00-4333-57). Cells were pelleted by centrifugation ...
-
bioRxiv - Molecular Biology 2022Quote: 3′-RACE was used to determine the length of the mRNA 3′UTRs using the 3′RACE System for Rapid Amplification of cDNA Ends kit (Thermo Fisher Scientific, Carlsbad, CA, USA). Yeast total RNA used for steady-state and half-life northern blots was used to generate cDNA using SuperScript™II RT (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with following primary antibodies and/or labelling agents: anti-GFP (Invitrogen, #11122, 1:800, 3 days or Invitrogen, #10262, 1:800, 3 days), anti-V5 (Invitrogen ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
Diurnal regulation of SOS Pathway and Sodium Excretion Underlying Salinity Tolerance of Vigna marinabioRxiv - Plant Biology 2024Quote: ... From the extracted RNA we prepared libraries for 3’mRNA-seq with Collibri 3’mRNA Library Preparation Kit for Illumina Systems (Thermo Fisher Scientific K.K., Tokyo, Japan). The prepared libraries were sequenced with Hiseq4000 as a customer service of GeneBay Inc ...
-
bioRxiv - Pathology 2021Quote: ... The APP mAb 22C11 (Invitrogen) was used at a dilution of 1:3,000 for western blot.
-
bioRxiv - Microbiology 2020Quote: ... mouse anti-His mAb (Invitrogen) and anti-GAPDH mAb (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... and anti-CD8 MAb (ThermoFisher) were employed at 1/50 dilution.
-
bioRxiv - Microbiology 2020Quote: ... The c-Myc epitope was detected with mouse mAb 9E10 (59) or rabbit pAb anti-Myc (Invitrogen PA1981). His6-tagged proteins were recognized with mouse anti-His6 (R&D systems MAB050) ...
-
bioRxiv - Bioengineering 2022Quote: ... Hydrogels were then labeled with primary 5-methylcytosine (recombinant rabbit monoclonal, ThermoFisher RM231, 1:200) antibody ...
-
bioRxiv - Biophysics 2023Quote: ... and subsequently incubated in the same buffer with 1:300 Tom20 Recombinant rabbit antibody (Invitrogen) overnight at 4°C ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated overnight at 4°C in blocking solution (PBS, 2% normal goat serum, 3% BSA) and primary antibodies (mouse anti-HA, Invitrogen; rabbit anti-GFP, Invitrogen). Cells were then immunolabeled with Alexa-conjugated secondary antibodies (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... and washed 3 times with PBS before incubation for 1 h with goat anti-rabbit IgG secondary antibody Alexa fluor 594 (Thermo Fisher Scientific, Waltham, MA), and 100 ng/mL DAPI (Sigma-Aldrich) ...
-
bioRxiv - Plant Biology 2020Quote: ... and a precise concentration measurement with the Qubit 3 (Invitrogen, USA). The integrity of the RNA was confirmed via agarose gel electrophoresis.
-
bioRxiv - Biophysics 2021Quote: ... and 1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine (DiD) were from Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... anti-TIM-3 clone F38.2E2 (ThermoFisher Scientific, catalog #16-3109-85) was used.
-
bioRxiv - Cancer Biology 2021Quote: ... cells were passaged every 3-4 days using Accutase (Life Technologies) and reseeded at 0.5×104 cells/mL on Geltrex-coated (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: Quantitative PCR reactions were run on a QuantStudio 3 (Applied Biosystems) using the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... in 100 μl of 3% bovine serum albumin (BSA, Fisher Scientific) diluted in PBS ...
-
bioRxiv - Molecular Biology 2020Quote: ... resolved on a 3-8% Tris-Acetate SDS PAGE gel (Invitrogen), and transferred onto a PVDF membrane ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were passaged every 3 days with 0.25% Trypsin-EDTA (Gibco).
-
bioRxiv - Cell Biology 2020Quote: ... the QuantStudio™ 3 Real-Time PCR System (ThermoFisher, cat# A28137) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 3:1 ratio with 1X penicillin/streptomycin (Gibco; 15070) and 5% FBS (Gibco ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 and 9 μg respectively using Lipofectamine 2000 (Thermo Fisher, 11668027). Infectious supernatant was collected at 48 and 72 hours after transfection and filtered to remove cell debris ...
-
bioRxiv - Genetics 2021Quote: ... and qPCR was performed in a QuantStudio 3 instrument (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DMSO (3% v/v final conc.) and dNTPs (Thermo Scientific, #R0191). Twenty-nine PCR cycles were performed using the manufacturer’s protocol (annealing temperature ...
-
bioRxiv - Microbiology 2020Quote: ... RNA (∼3 µg) was treated with 2 units turbo-DNase (Invitrogen) in 1X turbo-DNase buffer for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2020Quote: ... Electrodes were labeled with DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine; Invitrogen) for postmortem reconstruction of their tracks in histologic sections ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3’ adenine overhangs were added (AmpliTaq DNA Polymerase Kit, Life Technologies). PCR amplification was performed via Kapa Hifi DNA Polymerase (Kapa Biosystems ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA concentration was measured using a Qubit 3 fluorometer (ThermoFisher Scientific) with the dsDNA BR (Broad Range ...
-
bioRxiv - Developmental Biology 2020Quote: ... plus 3 μL lipofectamine RNAiMAX reagent (Thermo Fisher Scientific, cat. #13778075), following manufacturer protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... Quantitative PCR (qPCR) was performed using QuantStudio 3 (Thermo Fisher, U.S.) following the MIQE guideline(Bustin et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... the NuPAGE™ 3 to 8% Tris-Acetate gels (Invitrogen, EA03755) were used with Tris-Acetate SDS Running Buffer (pH 8.24 ...
-
bioRxiv - Biophysics 2022Quote: ... 3 mL of CO2-independent α-MEM culture medium (Thermo Fisher) was pipetted on top of the samples ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Taste receptor type 1 member 3 (Tas1r3, Rn00590759_g1, Applied Biosystems) and rat Taste receptor ...
-
bioRxiv - Neuroscience 2021Quote: ... in a Quant Studio 3 Real-Time PCR system (Thermo Fisher). Crossing threshold (Ct ...
-
bioRxiv - Neuroscience 2021Quote: ... by a wet-transfer apparatus (Vep-3, Thermo Fisher Scientific, U.S.A.). The membrane was washed by TTBS (0.9% NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 ml of dissection medium containing 10X trypsin (15400-054, Invitrogen) at 37°C for 15 minutes was added ...
-
bioRxiv - Neuroscience 2021Quote: ... with half media changes every 2-3 days with Neurobasal (ThermoFisher #21103049 supplemented with Primocin (InvivoGen #ant-pm-1) ...
-
bioRxiv - Molecular Biology 2020Quote: ... or 3%-8% NuPAGE Tris-Acetate Protein Gels (Thermo Fisher Scientific) for high molecular weight proteins ...
-
bioRxiv - Molecular Biology 2021Quote: 3×105 Flp-In™ T-REx™-293 cells (Invitrogen) were reverse transfected with 40 nM of a non-targeting or UPF1-specific siRNA that targets both UPF1 isoforms (described above ...
-
bioRxiv - Cell Biology 2022Quote: ... following a 3-hours treatment with 100 ng/mL colcemid (GIBCO) cells were trypsinized and recovered in a falcon tube ...
-
bioRxiv - Cell Biology 2022Quote: ... 3-5 × 105 cells were settled on Polysine Slides (Thermo Fisher), fixed with 4% ...
-
bioRxiv - Genomics 2020Quote: ... DNA concentration and purity were measured with a Qubit 3 (Invitrogen) and Nanodrop ND-1000 (Thermo Fisher Scientific) ...
-
The tumour microenvironment shapes dendritic cell plasticity in a human organotypic melanoma culturebioRxiv - Immunology 2019Quote: ... in Fibroblast medium (3:1 DMEM: Ham’s F12 Nutrient Mixture, Gibco) supplemented with 10% FCS ...
-
bioRxiv - Immunology 2019Quote: ... the CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) was added to the cells with complete media for 30 min in 37°C and the caspase-3/7 positive cells were measured on an Attune NXT flow cytometer (Life Technologies ...