Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for 6 Propyl 2 thioxo 2 3 dihydropyrimidin 4 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Cells were passaged 1:10 every 2–3 days with 1× trypsin-EDTA 0.25% (Gibco 25200-056).
-
Single-cell analysis of skeletal muscle macrophages reveals age-associated functional subpopulationsbioRxiv - Cell Biology 2022Quote: ... The suspension of pellet 2+3 was filtered through 40-μm cell strainer (Fisher scientific, Cat # 22363547), followed by final wash in complete Ham’s F10 medium ...
-
bioRxiv - Cell Biology 2021Quote: ... Peptides were loaded onto a C18 trap column (3 μm, 75 μm × 2 cm, Thermo Fisher Scientific) connected in-line to a C18 analytical column (2 μm ...
-
bioRxiv - Biochemistry 2022Quote: ... and after immobilization of HER2- Nb and HER2-Nb-GEPII 1.0 was assessed using 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyltetrazolium Bromide (MTT) reagent (ThermoFisher). After immobilization of HER2-Nb and HER2-Nb-GEPII 1.0 on the cell surface ...
-
bioRxiv - Neuroscience 2022Quote: BDA was visualized with fluorophore-conjugated streptavidin (Thermo Fisher Scientific, Table 2; 1:1,000 for 3 h). The reaction was enhanced using the biotinylated tyramine (BT)-glucose oxidase (GO ...
-
bioRxiv - Microbiology 2022Quote: ... All cells were passaged 2-3 times per week with 0.25% Trypsin/0.02% EDTA (Gibco Cat#25200056). Cells used in all experimental set-ups were between passage 5 and 30.
-
bioRxiv - Biochemistry 2021Quote: ... 2′-(or-3′)-O-(N-Methylanthraniloyl) adenosine 5′-triphosphate (mant-ATP, Thermo-Fisher Scientific, Waltham, MA, USA) was serially diluted to concentrations of 5 -15 μM in assay buffer and added to the myosin at a final concentration of 1X -1.2X the final concentration of myosin ...
-
bioRxiv - Cell Biology 2022Quote: ... All the LUVs contained 2 mol% of 1,2-dihexadecanoyl-sn-glycero-3-phosphoethanolamine (DHPE)-tRed (Molecular Probes). Lipids were mixed in chloroform ...
-
bioRxiv - Cancer Biology 2021Quote: ... antagomir 2 from Exiqon (miRCURY LNA microRNA Power Inhibitor; 4100464-002) and antagomir 3 from Thermo Scientific Dharmacon (miRIDIAN hairpin inhibitor ...
-
bioRxiv - Biochemistry 2021Quote: ... Peptides were injected into a trap column (nanoViper C18, 3 μm, 75 μm × 2 cm, Thermo Scientific) with 12 μL of solvent A (0.1% formic acid ...
-
bioRxiv - Cell Biology 2020Quote: ... Plasmid DNA (2-3 μg) was diluted in 400 μL Opti-MEM (11058021, Thermo Fisher Scientific, USA) spiked with 2-3 μL Plus reagent (15338100 ...
-
bioRxiv - Genomics 2020Quote: ... the skin samples were washed 2-3 times with buffer saline (1X PBS; Gibco, Thermo Fisher Scientific). The adipose tissue and associated blood vessels were removed ...
-
bioRxiv - Genomics 2020Quote: ... the skin samples were washed 2-3 times with buffer saline (1X PBS; Gibco, Thermo Fisher Scientific). The adipose tissue and associated blood vessels were removed ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were routinely passaged after 2-3 days or after reaching ∼80 % confluency using TrypLE Express (Gibco) for the detachment of cells from culture flasks ...
-
bioRxiv - Immunology 2022Quote: ... 2 μm paraffin-embedded kidney sections were incubated with an anti-cleaved caspase-3 antibody (ThermoFisher Scientific). After incubation with goat anti-rabbit-HRP secondary antibody (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2022Quote: ... in the reverse phase using a preconcentration column (75 μm DI × 2 cm, 3 μm, Thermo Scientific) and an analytical column (Acclaim PepMap C18 ...
-
bioRxiv - Genetics 2022Quote: ... Cells were passaged at 70-80% confluence every 2-3 days using Trypsin 0.25% EDTA (Life Technologies). mESCs were plated at a density of 1 x 105 cells/ml ...
-
bioRxiv - Microbiology 2022Quote: PBMCs were thawed according to standard procedure and rested 2-3 h in IMDM (Gibco/ThermoFisher Scientific) containing 5% human AB serum (SAB ...
-
bioRxiv - Microbiology 2022Quote: PBMCs were thawed according to standard procedure and rested 2-3 h in IMDM (Gibco/ThermoFisher Scientific) containing 5% human AB serum (SAB ...
-
bioRxiv - Microbiology 2022Quote: Anti-ORF8 mAb (#1-3-2) was coupled to aldehyde/sulfate latex beads (Thermo Fisher Scientific A37304). The antibody was mixed with the latex beads and shaken at room temperature overnight ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated for 2–3 minutes (mins) at room temperature in 0.05% (v/v) trypsin (Gibco 25300-054), and tapped to release ...
-
bioRxiv - Cell Biology 2023Quote: ... after the first fast centrifugation step platelets were incubated with 3 µM Fura-2 AM (#F1221, Invitrogen) and 0.2% Pluronic F-127 (#P3000MP ...
-
bioRxiv - Molecular Biology 2023Quote: ... An Acclaim PepMap 100 trap column (75 μm × 2 cm, C18, 3 μm, 100 Å, Thermo Scientific) was used together with an analytical PepMap RSLC C18 column (150 μm × 15 cm ...
-
bioRxiv - Neuroscience 2023Quote: ... The growth medium was changed every 2–3 days and consisted of DMEM/F12 (Fisher Scientific, 11330032) supplemented with 10% fetal bovine serum (Fisher Scientific ...
-
bioRxiv - Systems Biology 2023Quote: Total RNAs (2–3 μg) were extracted from tobacco leaves using PureLink Plant RNA Reagent (Invitrogen, #12322012) and used for cDNA synthesis with M-MLV Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Cancer Biology 2023Quote: Proliferation assays were performed using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Thermo Fisher Scientific) assay ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were incubated with 1.2mM 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT, Thermo Fisher Scientific) solution ...
-
bioRxiv - Systems Biology 2023Quote: ... or F-12K medium (Caisson; Hela-S3 and PC-3) supplemented with 2 mM L-glutamine (Gibco), 100 U/mL penicillin ...
-
bioRxiv - Molecular Biology 2021Quote: ... the input aliquot (100 µl) was mixed with equal volume of 2× protein sample buffer (2× NuPAGE LDS buffer [Life Technologies], 100 mM DTT, 4% [w/v] SDS) and the IP with 100μl 1 x protein sample buffer followed by incubation for 10 min at 75 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... and then incubated for 2 h at room temperature with one of the species-matching conjugated secondary antibodies (all from ThermoFisher Scientific): goat anti-mouse Alexa-Fluor 555 (cat ...
-
bioRxiv - Microbiology 2020Quote: ... RT-qPCR (SARS-CoV-2 and MS2 viral genome detection) were performed with the Express one step RT-qPCR Universal kit (ThermoFisher Scientific) using 3.5µL of RNA and 6.5µL of RT-qPCR mix that contains 250nmol of each primer and 75nmol of probe ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The final pooled library was diluted to an appropriate concentration and then subjected to Ion Sphere Particle (ISP) emulsion PCR amplification using an Ion One Touch 2 and an Ion PI Template OT2 200 Kit (Life Technologies). We sequenced the final library in two runs on an Ion Torrent Personal Genome Machine (Life Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... One half of each tissue sample was homogenised in 1ml DMEM medium containing 2% FBS supplemented with Penicillin/Streptomycin (Gibco, USA) for 5min at 30Hz using a Tissue Lyser II (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS CoV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Biochemistry 2021Quote: ... The protein was run over either one (at 10°C) or two (at 10°C and 2°C) immobilized pepsin columns (Applied Biosystems; Poroszyme Immobilized Pepsin Cartridge ...
-
bioRxiv - Immunology 2021Quote: ... SARS-CoV-2 nucleoprotein cDNA was generated from RNA from Bei Resources (NR-52285) by One-Step RT PCR (SuperScript IV, Thermo Fisher) with primers SARS COV-2 N IVT F1 (5’-GAATTCTAATACGACTCACTATAGGGGATGTCTGATAATGGACCC-3’ ...
-
bioRxiv - Immunology 2021Quote: ... and the SARS-CoV-2 spike gene was reverse-transcribed and amplified with a SuperScript IV One-Step RT-PCR kit (ThermoFisher Scientific) using primers flanking the S gene ...
-
bioRxiv - Plant Biology 2022Quote: ... and 2 mL of 1:10 diluted cDNA in an Applied Biosystems Step One Plus real-time PCR instrument (ThermoFisher, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: Cas12a-gRNA ribonucleoprotein complexes containing one sgRNA targeting the vault1-2 gene (TTTAGCTCAGCGGTTACTTCGAGTACA) were nucleofected in HEK293T using Neon Transfection System (Thermo Scientific). After 48 hours cells were single-cell sorted into 96-well plates and subsequently genotyped ...
-
bioRxiv - Biochemistry 2023Quote: ... The temperature was increased from 5 °C to 95 °C over 2 hours and readings taken using a One Step Plus RT-PCR (Applied Biosystems).
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Gels were then rinsed one time in deionized water and placed into an iBlot 2 mini transfer stack (Thermo Fisher Scientific). The transfer stack was loaded onto the iBlot 2 Gel Transfer Device (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... mRNA was co-transcriptionally capped using m7(3’OMeG)(5’)ppp(5’)(2’OMeA)pG capping reagent (Hongene Biotech) in a “one-pot” reaction followed by digestion with DNase I (Thermo Fisher). Linear mRNA was purified using Dynabeads MyOne Carboxylic Acid beads (Thermo Fisher).
-
bioRxiv - Neuroscience 2022Quote: Primary spinal microglia grown on poly D-lysine coated glass-bottom dishes were loaded with Fura-2 by incubating cells in 2 uM Fura-2-AM (Invitrogen) in growth medium for 30 min at 37℃ ...
-
bioRxiv - Immunology 2023Quote: ... 1-2 x 106 antigen-experienced 5c.c7 TCR-transgenic T-cells were incubated with 2 µM Fura-2-AM (Life technologies) in T-cell growth medium for 15-20 minutes at room temperature and subsequently washed with warm (room temperature ...
-
bioRxiv - Genomics 2023Quote: ... 2 µL of Superscript IV enzyme, 2 µL of 100 mM DTT and 2 µL of RNAseOut rnase inhibitor, Invitrogen) were added to each well ...
-
bioRxiv - Bioengineering 2022Quote: ... formalin-fixed fibrotic capsule tissue samples (n=2 per group) and subcutaneous tissue samples (n=2) were placed in a solution of 2 mg/ml FITC (Invitrogen) in DMEM/F12 media (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...