Labshake search
Citations for Thermo Fisher :
1501 - 1550 of 10000+ citations for 6 Propyl 2 thioxo 2 3 dihydropyrimidin 4 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 1% N-2-hydroxyethylpiperazine-N’-2-ethanesulfonic acid (HEPES, Gibco, #15630080) and 1% MEM nonessential amino acids (MEM-NEAA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2 µL of 5 mM aa-dUTP/dNTP mix (5 mM each dATP, dGTP and dCTP, 3 mM dTTP and 2 mM 5-(3-aminoallyl)-dUTP (Thermo Fisher Scientific, AM8439)) and 1.25 µL of 40 µM oligo 1 ...
-
bioRxiv - Microbiology 2022Quote: ... The surface of the master was treated with 1H,1H,2H,2H-perfluo-rooctyltrichlorosilane (Thermo Scientific) to promote the removal of elastomer ...
-
bioRxiv - Genomics 2021Quote: ... One replicate was treated with blasticidin (Gibco, A1113903, 4 µg/mL), and the other replicate was not treated with blasticidin ...
-
bioRxiv - Developmental Biology 2022Quote: ... One volume of 4 °C DMEM (Thermo Fisher Scientific, Cat# 11960044) with 10% fetal bovine serum (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... and 4 °C hold at one cycle (QuantStudio 3.0, Applied Biosystems). The mean Ct value of technical replicates from the standard curve was analyzed and plotted using The Graph Prism 8.0 ...
-
bioRxiv - Cell Biology 2020Quote: ... Lysates were subsequently incubated for 2 hours at 4°C with Streptavidin Dynabeads (Invitrogen M-280), and beads were successively washed with RIPA (2 times) ...
-
bioRxiv - Physiology 2022Quote: ... Dionex Ionpac AG11-HC b (2 mm x 50 mm, 4 μm particle size, ThermoFisher Scientific), was placed before the separation column ...
-
bioRxiv - Biochemistry 2019Quote: ... 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA; Molecular Probes, Eugene, OR, USA) was used to detect NO production in sorghum genotype stalks in response to inoculation treatment at 7 DPI ...
-
bioRxiv - Physiology 2020Quote: ... brain tissue was removed and rapidly frozen using 2-methylbutane (Thermo Fisher Scientific, Cat# O3551-4) at -50°C to prevent tissue cracking ...
-
bioRxiv - Neuroscience 2020Quote: ... The samples were separated in a SDS-PAGE (2-4% gradient gel, NuPage™; ThermoFisher Scientific) and blotted to a PVDF membrane (300 mA ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 mM of the serine protease inhibitor 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (ThermoFisher Scientific). The samples were further ruptured using a syringe and centrifuged at 14,000g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 mM of the serine protease inhibitor 4-(2-aminoethyl) benzenesulfonyl fluoride hydrochloride (ThermoFisher Scientific). The samples were sonicated and centrifuged at 14,000g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... and then flash-frozen in dry-ice-chilled 2-methylbutane (−40 °C) (#03551-4, Fisher Scientific). Regions of interest were collected from these slices using a 1 mm biopsy micropunch (#15110-10 ...
-
bioRxiv - Cell Biology 2022Quote: ... for 2 hours at 4°C and incubated with 40ul washed Dynabeads Protein G (Invitrogen 10003D) for 1 hour ...
-
bioRxiv - Cell Biology 2022Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher Scientific, Cat. no. 15630-080,) and 1% penicillinstreptomycin (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: ... 0.1 M 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (pH = 8.5) (ThermoFisher Scientific, Waltham, MA), 4-benzoylbenzyl-trimethylammonium chloride (PLPP ...
-
bioRxiv - Developmental Biology 2023Quote: ... Immunoprecipitation was performed at 4°C for 2 h in micro-spin column (Thermo Scientific, 89879), and the beads were washed three times with lysis buffer and two times with Mass Spec buffer (0.1 M Tris-HCl in mass grade water ...
-
bioRxiv - Cell Biology 2022Quote: ... typically 2-20 μg samples were loaded on 4–12% Bis-tris gradient gels (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... The supernatants were first precleared for 2 h at 4°C using Protein G Dynabeads (Invitrogen). Precleared samples were immunoprecipitated with anti-H3K9me3 (abcam ...
-
bioRxiv - Neuroscience 2023Quote: ... The pellet was resuspended in 4 mL trituration buffer (Hibernate-A with 2% B27; ThermoFisher Scientific) and 2 mM sodium pyruvate (ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... 2 µg of plasmid DNA was mixed with 4 µL of Lipofectamine 2000 (ThermoFisher Scientific #11668019) in 300 µL of Opti-MEM without any additives ...
-
bioRxiv - Immunology 2023Quote: ... pre-coated (5 μg cm−2) 4-well chamber slide (Thermo Fisher Scientific, cat. no. 154526). A fluorescence image was captured using an LSM 880 confocal microscope (Carl Zeiss AG ...
-
bioRxiv - Physiology 2023Quote: ... isolated FDB fibers were loaded with 4 µM fura-2 AM (Thermo Fisher, Carlsbad, CA, USA) in Ringer’s solution at room temperature (RT ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Embryos older than 4 days were treated with 2 u/µl T1 RNAse (Thermo Fisher Scientific) after probe washing in order to reduce background ...
-
bioRxiv - Genetics 2024Quote: ... media was half-changed every 4 days with 2 µg/mL Natural Mouse Laminin (ThermoFisher Scientifics). Recordings were performed starting on day 115 using a Maestro Edge MEA system and AxIS Software Spontaneous Neural Configuration and Viability Module ...
-
bioRxiv - Biophysics 2020Quote: ... Grids were blotted for 2-4 seconds at a blotting force of 4 and plunge-frozen in liquid ethane using a MarkIV Vitrobot (Thermo Fisher Scientific). The chamber was maintained at 8 °C and 100% humidity during freezing ...
-
bioRxiv - Neuroscience 2019Quote: ... Supernatant was kept after spinning at 800 rcf for 2’ at +4°C and were incubated overnight at +4°C with 3µg of dedicated antibodies: Nr2f1 antibody (Thermo Fisher PA5-21611) and GFP antibody (Abcam ab13970 ...
-
bioRxiv - Immunology 2020Quote: ... 2-4 × 105 cell equivalents per well were loaded into a NuPAGE 4-12% Bis-Tris density gradient gel (Thermo Fisher Scientific) and ran at a constant 150V for 80 minutes ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded with the calcium indicator Fluo-4 by incubating in supplemented NB medium that contained 2 µM of Fluo-4 AM (Invitrogen, Carlsbad, CA), and Pluronic F-127 (0.04% ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Neuroscience 2022Quote: One-step quantitative real-time PCR was performed in a QuantStudio 6 (Thermo Fisher) using GoTaq® Probe 1-Step RT-qPCR System (Promega) ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl cDNA (diluted 1:20) was used in a 6 µl Fast SYBR Green qPCR reaction (ThermoFisher Scientific). No-template controls for each gene were run in all qPCR plates ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Microbiology 2021Quote: SARS-CoV-2 (438-516) S-RBD((HiS)6 and biotynilated human ACE2 have been purchased from Fisher Scientific (respective references 16534204 and 16545164) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were plated at 1 x 10^6 cells per well of a 6 well plate or 5 x 10^6 cells per T25 flask in stage 2 media consisting of 47.5% IMDM (Gibco), 47.5% F12 (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... or in 2 ml liquid MSgg with 7-d-old tomato seedlings in a 6-well plate (Thermo Scientific). Each well contained one seedling ...
-
bioRxiv - Cancer Biology 2022Quote: T98G cells (2 × 105 into 6 well plate) were reverse transfected with siRNAs (Table S3) using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: Liver-Chips were stained in the upper channel with 5(6)-Carboxy-2′,7′-dichlorofluorescein diacetate (CDFDA) (Thermo Fisher) to visualize bile canaliculi and MRP2 activity ...
-
bioRxiv - Bioengineering 2020Quote: We used a mixture of 6 μm and 2 μm diameter fluorescence beads (C16509, Thermo Fisher; F8825 Thermo Fisher) in our experiment ...
-
bioRxiv - Bioengineering 2020Quote: We used a mixture of 6 μm and 2 μm diameter fluorescence beads (C16509, Thermo Fisher; F8825 Thermo Fisher) in our experiment ...
-
bioRxiv - Microbiology 2021Quote: ... Dissociated cells and remaining pieces of tissue were placed in a single well of a 6-well plate containing 2 mL of Dulbecco’s Modified Eagle Medium (DMEM, Gibco) containing 20% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Genetics 2019Quote: Beginning at week 2 post cloning and continuing until week 6 the Phusion Blood Direct PCR Kit (Thermo Scientific) was utilized to identify positive clones ...
-
bioRxiv - Neuroscience 2022Quote: 3D tissue viability was checked at 2 and 6 weeks after seeding following the established Calcein AM (Invitrogen, C1430) staining protocol ...
-
bioRxiv - Molecular Biology 2022Quote: Membrane order was assessed using the polarity-sensitive membrane probe Laurdan (6-Dodecanoyl-2-Dimethylaminonaphthalene) (Thermo Fisher Scientific, D250)20 ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue fragments weighing 200 mg were placed in a 6-well plate containing 2 ml of Hibernate E (Gibco) in each well and were carefully dissociated until all the pieces were the same size ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was resuspended in 1 ml of DMEM before adding the mixture to a 6-well plate containing 2 ml of DMEM with 4.5 g/L D-Glucose and L-Glutamine (Gibco) supplemented with supplemented 10% FBS ...
-
bioRxiv - Genomics 2023Quote: ... and the relative expression was determined by the 2-ΔΔCt method on a QuantStudio 6 qPCR machine (Thermo Fisher). The levels of mRNAs were normalized to human ACTB.
-
Parkinson’s VPS35[D620N] mutation induces LRRK2 mediated lysosomal association of RILPL1 and TMEM55BbioRxiv - Neuroscience 2023Quote: MEF cells were grown in a 6 well plate seeded at 50–60% confluency in 2 ml Dulbecco’s modified Eagle medium (DMEM, Gibco) containing 10% (v/v ...