Labshake search
Citations for Thermo Fisher :
1551 - 1600 of 10000+ citations for 6 Methyl 2 Mercaptobenzothiazole since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... in Essential 6 medium (Thermo Fisher Scientific, A1516401) supplemented with patterning molecules ...
-
bioRxiv - Microbiology 2024Quote: ... on a QuantStudio 6 instrument (Thermo Fisher Scientific). ACTB and GAPDH were used as endogenous controls for relative quantification analysis ...
-
bioRxiv - Systems Biology 2024Quote: ... qPCR was performed using QuantiStudio 6 (Life Technologies) with SYBR Power Green (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... 0.5% 2-mercaptoethanol (2-ME) (GIBCO) and 1% HEPES (GIBCO) ...
-
bioRxiv - Systems Biology 2021Quote: ... The cells were maintained in fibroblast media for 6 days then passaged onto Matrigel-coated dishes for further reprogramming in Essential 6 medium plus human bFGF (ThermoFisher Scientific). The iPSC colonies were manually picked onto Matrigel-coated plates to generate stable iPSC lines ...
-
bioRxiv - Systems Biology 2021Quote: ... The cells were maintained in fibroblast media for 6 days then passaged onto Matrigel-coated dishes for further reprogramming in Essential 6 medium plus human bFGF (ThermoFisher Scientific). The iPSC colonies were manually picked onto Matrigel-coated plates to generate stable iPSC lines ...
-
bioRxiv - Developmental Biology 2022Quote: ... embedded in paraffin using the Tissue-Tek VIP 6 (Sakura) tissue processor and of 6 µm sections obtained with a microtome (HM355S, Thermo Scientific). Z-shaped probes for Sema6d (565871) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Systems Biology 2020Quote: 1×10^6 cells were seeded in wells of 6-well plates (FALCON # 353046) in MEM without phenol red (Gibco # 51200038) supplemented with 0.5% Fetal Calf Serum (VWR #89510-184) ...
-
bioRxiv - Microbiology 2023Quote: ... cells were plated at 650,000 cells per well of a 6 well plate and infected with 6 dilutions from a 10-fold dilution series in 1% FBS (Gibco, MA)/1X non-essential amino acids (Gibco ...
-
bioRxiv - Cell Biology 2023Quote: ... The IL-6 levels in plasma were analyzed using a Mouse IL-6 Uncoated ELISA kit (#88-7064, Invitrogen, MA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Cell Biology 2024Quote: Cells were seeded at 30 000 cells/cm2 and were treated 6 h later with 6 µM of the calcium-sensitive Rhod2AM probe (ThermoFisher Scientific) for 1 h before refreshing the cell culture medium ...
-
bioRxiv - Biochemistry 2024Quote: ... Transfection of 1 µg per well of plasmids encoding SARS-CoV-2 tag-free nucleocapsid protein was performed using 6 µL per well of Lipofectamine 2000 on HEK-293T cells with 70-80% confluency on 6-well plates (Invitrogen, 11668027). Compounds were added to the cells with fresh media after 6 hours of incubation with plasmids for 24-hour treatment before cell lysis and immunoblotting ...
-
bioRxiv - Plant Biology 2020Quote: ... the samples were centrifuged before receiving 50 µL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1% trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Systems Biology 2021Quote: ... the samples were centrifuged before receiving 50 μL of N-Methyl-M (trimethylsilyl) trifluoroacetamide (MSTFA) + 1 % trimethylchlorosilane (TMCS) (ThermoFisher Scientific, Waltham, MA, USA), briefly vortexed and incubated at 60 °C for 40 min ...
-
bioRxiv - Genomics 2020Quote: ... Primers specific for the methylated bisulphite converted DNA (GAGGAGGAGGGGGTTTGTTAT and AAATCAATAACCTAATAACCACACAC) were designed using Methyl Primer Express (Applied Biosystems, Foster City, CA, USA). After PCR amplification ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Dried samples were dissolved in 250 µl of silylation-grade acetonitrile followed by addition of 250 µl of N-methyl-N- (trimethylsilyl)trifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (TMCS) (Thermo Scientific, Bellefonte, PA) and heated for 1 hr at 70 °C to generate trimethylsilyl derivatives ...
-
bioRxiv - Molecular Biology 2021Quote: ... cryosectioned zebrafish larvae were washed 3x in wash buffer for 5 min and subsequently stained with Filipin solution for 60 min in a humidified dark chamber and co-stained with BODIPY TR methyl ester (1:300, Life Technologies, Darmstadt, Germany). Staining solution was removed and slides were washed twice in wash buffer ...
-
bioRxiv - Neuroscience 2021Quote: ... samples were stained with CellTrace BODIPY TR methyl ester (1:200 in PDT [1 % DMSO, 0.1 % Triton X-100 in PBS], cat# C34556, Thermo Fisher Scientific, Waltham, MA) for 20 min at RT and/or DAPI (5 mg/ml ...
-
bioRxiv - Systems Biology 2023Quote: ... Val-Tyr-Val, methoxyamine hydrochloride (MeOX), N-methyl-N-(trimethylsilyl)-trifluoroactamide (MSTFA), and pyridine (Anhydrous, 99.8%) were all purchased from Fisher Scientific (Hampton, NH, USA). Fatty acid methyl esters (FAMEs ...
-
bioRxiv - Plant Biology 2022Quote: ... The sample was dried under a stream of air and resuspended in 50μL of N-methyl-N-(trimethylsilyl) trifuoroacetamide (MSTFA) (Fisher scientific, Waltham, MA, USA), votexed to mix for 20 sec ...
-
bioRxiv - Molecular Biology 2023Quote: The mitochondrial membrane potential was measured using the tetramethylrhodamine methyl ester (TMRM, 50 nM, Life technology, T668) and Mitotracker Green (100nM, Thermo Fisher Scientific, M7514) fluorescent probes according to the manufacturers’ protocols ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Genomics 2023Quote: ... The right femurs of Inbred Founders were dehydrated in ethanol and embedded in poly methyl methacrylate (PMMA) (Thermo Scientific AAA130300F, Thermo Fisher Scientific). Plastic blocks were cut at the midpoint perpendicular to the bone long-axis and trimmed to 5 mm in length ...
-
bioRxiv - Cell Biology 2024Quote: ... The supernatant was aspirated and the cell pellet was resuspended in 150 μL KCl buffer (for composition, see Ca2+ uptake protocol above) supplemented with 500 nM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher Scientific, I34361) and 0.005% digitonin (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Firstly proteins were precipitated with 50 μL of acetonitrile followed by steroid extraction via liquid-liquid extraction with 1 mL tert-methyl butyl ether (MTBE, Acros Organics, Fisher Scientific, UK). The MTBE layer was then removed ...
-
bioRxiv - Neuroscience 2024Quote: ... Two-phase extraction was performed by adding 400 µl of methyl-tert-butyl ether (MTBE): methanol (3:1, v/v; all solvents of High-performance liquid chromatography (HPLC)-grade (Thermo Fisher Scientific, Germany)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing 2 μM Fura-2 acetoxymethyl ester (Fura-2 AM; ThermoFisher Scientific) and 0.01% pluronic acid (Merck ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Molecular Biology 2020Quote: ... (G4S)6 Linker-VH/CH1 and (G4S)6 Linker-VH/CH1-(G4S)6 Linker-VH/CH1 sequences were synthesized using GeneArt® gene synthesis service (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... Adult cardiac NMCs were isolated from adult C56BL/6 mice (6-8 weeks old) by digesting adult ventricles in buffer containing 1 mg/ml collagenase IV (Gibco 17104-019) and 1.2 mg/ml dispase II (Sigma ...
-
bioRxiv - Genomics 2021Quote: ... cells were seeded in 6-well plates or 6 cm dishes and reverse transfected with 5 nM Silencer Select siRNAs (Thermo Fisher Scientific) using RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Systems Biology 2019Quote: ... iPSC cultures at ~90% confluence in 6-well-plates were treated with 6 μM CHIR-99021 (SelleckChem) in RPMI 1640 medium supplemented with B27 supplements (Thermo Fisher Scientific) for 2 days to induce mesoderm specification ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: Bone marrow was collected from tibias and femurs of 4-6 mo female C57BL/6 mice and cultured for 7 days at 37°C and 5% CO2 in DMEM (Gibco,11995-073) supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... was co-transfected with either pre-gRNA or gRNA expression plasmids (1 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cells were first transfected with the pcDNA3_CasRx-GFP plasmid (2.5 µg per 6-well) using Lipofectamine 3000 kit (5 µl Lipo 3000 and 5 µl P3000 reagents per 6-well; Thermo Fisher Scientific) according to the manufacturer’s guidelines ...
-
bioRxiv - Bioengineering 2024Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Invitrogen, Cat # N13195) and incubated for 30 minutes in their respective culture conditions ...
-
bioRxiv - Biophysics 2020Quote: A 6-well plates (Nalge Nunc International, Roskilde, Denmark) was treated with Poly-L-Lysine (PLL ...
-
bioRxiv - Cell Biology 2020Quote: ... and 1.5 μg Random Primer Pd(N)6 (Invitrogen). RNA was denatured at 65°C for 2 min and then added to 40 U RNAse inhibitors (RNaseOUT-Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... media was changed to Essential 6 Medium (Gibco; A1516401), 24 hours later cells were treated with 200ng/ml FGF8b (PeproTech ...
-
bioRxiv - Neuroscience 2019Quote: ... Transient transfection was performed with Fugene 6 reagent (Invitrogen) according to the manufacturer’s instructions.
-
bioRxiv - Biochemistry 2019Quote: ... with a supplement of 6 mM GlutaMAX (Gibco, 35050061) and 10 ml/l HT supplement 50X (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: Cells were transferred into 6-well plates (Fisher Scientific) for immunoblotting experiments or 35 mm glass-bottom dish (Mattek ...
-
bioRxiv - Cell Biology 2019Quote: ... and 6 mM L-glutamine (#25030-024, Life Technologies). Cell lines used were authenticated and routinely confirmed to be negative for any mycoplasma contamination ...
-
bioRxiv - Biochemistry 2020Quote: ... and (ii) 6 μl of Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... in 6-well Falcon plates (Fisher Scientific, Cat #087721B). The next day ...
-
bioRxiv - Biochemistry 2020Quote: ... was mixed with 5/6 TAMRA-OSu (Thermofisher #C1171) in DMSO ...
-
bioRxiv - Cancer Biology 2020Quote: ... One ng/mL recombinant human interleukin (IL)-6 (Gibco, Thermo Fisher Scientific ...