Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for Anion Exchange Membranes Thickness 10 13 µm since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: FluoroSphere (2 µm) stock solution [(ThermoFisher) was added to the collagen gel mixture (1.5mg/ml ...
-
bioRxiv - Developmental Biology 2024Quote: ... Hoechst 33342 (0.4 µM; Invitrogen, H3570) was used for nuclear staining ...
-
bioRxiv - Immunology 2024Quote: ... and 400 µM Sodium Pyruvate (Gibco)).
-
bioRxiv - Immunology 2024Quote: ... and 2.5 µM Fluo-4 (Invitrogen), in the presence of 0.1% Pluronic-F127 (Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... with 5 µM Puromycin (Gibco, #A1113803). Neurons were fixed for 15 min on ice with 4% PFA in 1X PBS ...
-
bioRxiv - Microbiology 2024Quote: ... particle size 3 µm (Fisher Scientific) followed by separation using a 125-min gradient from 5 to 35% buffer B (0.5% formic acid in 80% acetonitrile ...
-
bioRxiv - Immunology 2024Quote: ... 2.5 µM Oligo(dT) (Thermo Scientific), 1X Maxima H RT buffer (Thermo Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µm material (Thermo Fisher Scientific) which was heated to 60 °C ...
-
bioRxiv - Immunology 2024Quote: ... using 5 µM thapsigargin (Thermo Fisher) to mobilize Ca2+ from intracellular stores ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µm material (Thermo Fisher Scientific) heated to 60 °C via the integrated column heater at a flow rate of 300 nl min-1 using a 140 min gradient.
-
bioRxiv - Molecular Biology 2024Quote: ... 30 µM dTTP (ThermoFisher Scientific, #R0181) and 30 µM dmCTP (Jena Bioscience ...
-
bioRxiv - Molecular Biology 2024Quote: ... 30 µM dGTP (ThermoFisher Scientific, #R0181), 30 µM dTTP (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 24 µM dATP (ThermoFisher Scientific, #R0181), 6 µM Fluorescein-dATP (Jena Biosciences ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.6 µm particle (Thermo Fisher Scientific) column maintained at 40°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and Alexa 594 (50 µM, Invitrogen) were loaded into the superficial GCL or the GL via a glass pipette sized around 2 MΩ ...
-
bioRxiv - Neuroscience 2024Quote: ... Sulforhodamine-101 (SR101, ≈ 0.1 µM; Invitrogen) was added to the ACSF to visualise blood vessels for orientation and damaged cells in the red fluorescence channel of the microscope (56) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 µM 2-Mercaptoethanol (Thermo Fisher) 3 µM GSK3- inhibitor (CHIR99021 ...
-
bioRxiv - Biochemistry 2024Quote: ... 200 µM PMSF (Thermo Fisher Scientific) and 1 µg/ml pepstatin A (Merck) ...
-
bioRxiv - Biophysics 2024Quote: ... 2 µm-diameter fluorescent beads (Invitrogen) were added to the cell culture medium at a 1:5000 dilution and were incubated with the cells for 60 hours at 37°C with 5% CO2 ...
-
bioRxiv - Biochemistry 2024Quote: ... 1.9 µm column (Thermo Scientific,1893471) connected to a 5 cm x 20 µm ID Sharp Singularity Fossil Ion Tech tapered tip mounted in a custom constructed microspray source ...
-
bioRxiv - Cell Biology 2024Quote: ... 75 µm × 2 cm (Thermo Scientific) and EASY-Spray PepMap RSLC C18 ...
-
bioRxiv - Cell Biology 2024Quote: ... 75 µM × 25 cm (Thermo Scientific), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... or 5 µM dihydroethidium (Invitrogen, D11347) at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... and 50 µM 2-mercaptoethanol (Gibco), or frozen for long-term storage in basal media ...
-
bioRxiv - Developmental Biology 2024Quote: ... 5 µm trap (Thermo Fisher Scientific) on a switching valve ...
-
bioRxiv - Neuroscience 2020Quote: ... and transferred to membranes using the iBlot nitrocellulose membrane Blotting system (Invitrogen) by following manufacture protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... nylon membranes (Biodyne® A Pre-Cut Membranes – Thermo Scientific, Cat.No. 77015) were soaked in 0.5X TBE for 10 min and the gels ...
-
bioRxiv - Microbiology 2024Quote: Membrane potential was measured using a BacLight Membrane Potential Kit (Thermo Fisher). Cells were grown in CDM to the desired growth phase ...
-
bioRxiv - Neuroscience 2024Quote: ... and transferred to membranes using the iBlot nitrocellulose membrane Blotting system (Invitrogen) by following manufacture protocol ...
-
Planarian CREB-binding protein (CBP) gene family regulates stem cell maintenance and differentiationbioRxiv - Developmental Biology 2020Quote: ... TMUS-13 and AA4.3 and Alexa 568-conjugated goat anti-rabbit diluted 1:1000 (Molecular Probes) for PH3 and SMEDWI-1 ...
-
bioRxiv - Bioengineering 2020Quote: ... Slices were immunolabeled using primary antibodies GFAP (1:1000 dilution, rat IgG2a, Invitrogen cat# 13-0300) to label astrocytes ...
-
bioRxiv - Plant Biology 2021Quote: ... 13 days old whole seedlings were harvested at zeitgeber 22 (ZT) in RNA later solution (Thermofisher) and leaf 3 blades were dissected with a razor ...
-
bioRxiv - Immunology 2021Quote: ... UltraComp eBeads™ and mouse IL-5/IL-13 ELISA kits were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2022Quote: ... fixed and permeabilized eyecups were incubated with anti P-cadherin rat monoclonal antibody (13-2000Z, Invitrogen), in PBS containing 0.2% Triton-X 100 and 1% BSA at 1:500 dilution ...
-
bioRxiv - Genomics 2022Quote: ... 1:200 dilution of Anti-Mouse SSEA1 Biotinylated antibody (Thermo Fisher Scientific, Cat#: 13-8813-80), 1:200 dilution of Anti-Mouse Gr-1 APC-Cy7 antibody (Biolegend ...
-
bioRxiv - Synthetic Biology 2020Quote: ... RT-PCR products obtained from round 13 were cloned with TOPO TA Kit (Invitrogen; Carlsbad, CA) according to the manufacturer’s indications ...
-
bioRxiv - Cell Biology 2022Quote: ... Huh7 YFP-TIA1 Neo cells (13) were supplemented with 1 mg/ml G418 (Invitrogen, Life Technologies). Huh7 YFP-TIA1 Neo PKR Blr cells and Huh7 PKR Blr cells (PKROE)(13 ...
-
bioRxiv - Cell Biology 2022Quote: ... Huh7 YFP-TIA1 Neo cells (13) were supplemented with 1 mg/ml G418 (Invitrogen, Life Technologies). Huh7 YFP-TIA1 Neo PKR Blr cells and Huh7 PKR Blr cells (PKROE)(13 ...
-
bioRxiv - Developmental Biology 2021Quote: ... were: rat anti-E-cadherin (1:500, Thermo Fisher, Cat. No. 13-1900, clone ECCD-2), goat anti-Sox2 (1:150 ...
-
bioRxiv - Molecular Biology 2021Quote: Immortalized mesangial cells (SV40 MES 13, ATCC) were cultured in DMEM (Invitrogen Corporation, Gaithersburg, MD, USA) containing 10% fetal bovine serum (FBS) ...
-
bioRxiv - Immunology 2021Quote: ... on day 4 after re-stimulation with phorbol 12-myrisate 13-acetate (PMA; 10nM; Life Technologies) and ionomycin (1uM ...
-
bioRxiv - Bioengineering 2023Quote: ... at a concentration of 50 nM (final concentration) using Lipofectamine RNAiMAX (Cat. #13-778-150, Invitrogen) transfection reagent following manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: The primary antibodies used in this study included: rat anti-Gfap (1:1000, Thermofisher, #13-0300); guinea pig anti-Gfap (1:1000 ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by incubation with rat anti-E-cadherin primary monoclonal antibody ECCD-2 (Invitrogen, 13-1900) diluted at 1:500 overnight at 4°C with gentle rocking ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... fixed oocytes were first incubated with a mouse monoclonal against alpha-tubulin (LifeTechnologies-Invitrogen, 13-800), followed by an incubation with chicken anti-mouse IgG conjugated to Alexa Fluor 488 (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfected cells incubated in primary antibodies: mouse anti-c-myc 9E10 (1:1000, Invitrogen# 13-2500), rabbit anti-Tyr165 (1:250 ...
-
bioRxiv - Immunology 2022Quote: ... The following primary antibodies were used: rat anti-GFAP (#13-0300, Thermo Fisher Scientific; 1:400), rabbit anti-Calbindin (#Abcam ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were seeded 24 hrs before the experiment in 13 mm sterile glass coverslips (Thermo scientific). Cells were then washed with PBS and fixed with 4% PFA for 15 min at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... or siRNAs against mouse Adgrg6 (MSS278013: #13 CGACUGCCAAGGGCCUGUCAUUUAA MSS210995: #95 GCCUCCAAAUUUGCUUGAGAAUUUA; MSS210997: #97 CCGUGUUACCCUAAUGACUACCCUA, ThermoFisher Scientific). Transfection was performed using Lipofectamine 2000 (LS11668019 ...
-
bioRxiv - Plant Biology 2022Quote: ... 13 and 14 promoters were amplified with specific primers using Phusion HF polymerase (Thermo Fisher Scientific), and PCR amplicons were sequenced by Sanger sequencing (Microsynth seqlab) ...