Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Movies were collected on a Titan Krios G3i at spot size 7 with a Falcon 4 Direct Detector (Thermo Fisher Scientific) equipped with an energy filter set to 20 eV ...
-
bioRxiv - Immunology 2019Quote: ... Bacteria were labeled with 5 μM Syto™ 9 Green Fluorescent Nucleic Acid Stain or 500 nM pHrodo Red SE (ThermoFisher Scientific, Waltham, MA) and washed 3-5 times with PBS prior to infection ...
-
bioRxiv - Microbiology 2023Quote: Human bladder epithelial cell (BEC) line 5637 (ATCC HTB-9) was maintained at 37°C and 5% CO2 in RPMI 1640 media (ThermoFisher Scientific, Waltham, MA, USA) supplemented with 10% fetal bovine serum and 2 mM Glutamine ...
-
bioRxiv - Molecular Biology 2023Quote: ... pleomorphic BF EATRO 1125 [46] and transfected cells were grown at 37°C and 5% CO2 in HMI-9 media [47] (Life Technologies, Carlsbad, CA, USA) supplemented with 10% (vol/vol ...
-
bioRxiv - Genomics 2021Quote: ... Samples were transferred to 1.5 mL safe-lock tubes containing one scoop of acid-washed glass beads (<106μM) and 1 mL TRIzol (Invitrogen) containing 20μg/mL GenElute-LPA (Sigma-Aldricht ...
-
bioRxiv - Molecular Biology 2019Quote: ... were maintained in monolayer culture at 37°C and 5% CO2 in one of the following medium: Medium A contained DMEM (4.5 g/L glucose; Gibco) supplemented 100 U/ml penicillin and 100 µg/ml streptomycin sulfate ...
-
bioRxiv - Microbiology 2022Quote: ... One ml of fd or Pf4 phage (5 mg/ml) was incubated with 100 µg A488 fluorescent dye (ThermoFisher) for 1 hour at room temperature (RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 5 mM EDTA) in the presence of one tablet of the protease inhibitor cocktail per 25 ml (Complete, Invitrogen). Cell lysates were analyzed by 12% SDS-PAGE for 80 min at 100 V (Mini-Protean Cell ...
-
bioRxiv - Genetics 2019Quote: ... Day 6–7: DMEM (Gibco) with 25 mM glucose containing 1:100 B27 (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 7-AAD (Thermofisher Scientific) for 30min ...
-
bioRxiv - Developmental Biology 2021Quote: ... 7 (Applied Biosystems, Zug, Switzerland).
-
bioRxiv - Cancer Biology 2021Quote: ... 7-AAD (ThermoFisher Scientific, #A1310), AnnexinV-PE (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7’-Dichlorofluorescin diacetate (DCFDA; Invitrogen). DCFDA is de-esterified into its fluorescent form after action of intracellular esterases and oxidation by reactive oxygen species within the cell (Ishii et al. ...
-
bioRxiv - Microbiology 2021Quote: ... MgCl2 (ThermoFisher AM9530G; 7 mM), and SmartScribe Reverse Transcriptase (TaKaRa 639538 ...
-
bioRxiv - Neuroscience 2021Quote: ViiA 7 system (Applied Biosystems)
-
bioRxiv - Cell Biology 2021Quote: ... 7’ dichlorofluorescein diacetate (DCFDA, Invitrogen at 37°C for 30 min ...
-
bioRxiv - Developmental Biology 2020Quote: Cos-7 cells (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... 7-AAD (Thermo Fisher Scientific) and Annexin-V PE (BD ...
-
bioRxiv - Biophysics 2022Quote: ... 7 kDa MWCO (Thermo Scientific). Terminase protomer was exchanged into a 200 mM ammonium acetate salt ...
-
bioRxiv - Bioengineering 2024Quote: ... 7 kDa MWCO (Thermo Scientific). The extent of biotinylation was measured using the QuantTag Biotin Quantification kit (Vector Laboratories ...
-
bioRxiv - Developmental Biology 2023Quote: ... using 7-AAD (ThermoFisher Scientific) as a dead stain.
-
bioRxiv - Developmental Biology 2023Quote: ... using 7-AAD (ThermoFisher Scientific) as a dead cell stain ...
-
bioRxiv - Cell Biology 2020Quote: ... or DiD (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindodicarbocyanine perchlorate, aka DiIC18(5)) (Thermo Fisher #D307) at a final concentration of 4 μg/mL ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were washed 3 times in 5% Bovine Serum Albumin (BSA; ThermoFisher Scientific, 11423164) in PBS then incubated with primary antibody to H2AX (Ser139) ...
-
bioRxiv - Genomics 2019Quote: ... using TVN PCR reverse primer (5’-CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTVN-3’) and SuperScript III Reverse Transcriptase (Invitrogen), and then the reaction was stopped by heating at 70°C for 15min ...
-
bioRxiv - Cell Biology 2019Quote: ... 3 min each) and digested for 5 min with proteinase K (10μg/mL; Ambion). Tissue sections were allowed to hybridize overnight in a humid chamber at 65°C with 1 ng/µL of sense (negative probe ...
-
bioRxiv - Neuroscience 2019Quote: ... After 3 washes Hoechst 33258 nuclear stain (ThermoFisher H3569, 1:1500 for 5 min) was used to counter stain the nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 μg mtDNA were digested with 3 ul DraI Fastdigest restriction enzyme (Thermo Scientific) at 37°C for 3h and extracted with 1 volume phenol-chloroform ...
-
bioRxiv - Microbiology 2022Quote: ... FAM-5=CAT CCA ATC AAA GAC ATT GCG A 3=-TAMRA (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2021Quote: ... Coverslips were washed 3 × 5 min and mounted on slides using Prolong Gold (Invitrogen). Deconvolution wide-field microscopy was performed using the DeltaVision Elite system equipped with an NA 1.42 60x PlanApo objective (Olympus ...
-
bioRxiv - Developmental Biology 2022Quote: ... zLL 5’- and 3’- RACE PCRs were performed using the GeneRacer core kit (Invitrogen). Total RNA (2 µg ...
-
bioRxiv - Cell Biology 2022Quote: ... CCDC66 was depleted using an siRNA with the sequence 5′-CAGTGTAATCAGTTCACAAtt-3′ (Thermo Scientific). Silencer Select Negative Control No ...
-
bioRxiv - Immunology 2024Quote: ... tonsils were rinsed 3 x 5 minutes with 1X PBS (10010023, ThermoFisher Scientific, USA) without agitation ...
-
bioRxiv - Genomics 2024Quote: ... and a QuantStudio 3 or QuantStudio 5 Real-Time PCR instrument (Applied Biosystems™). Primers used for qPCR are listed in Suppl ...
-
bioRxiv - Cell Biology 2024Quote: ... si-PRELID1: 5’-CCCGAAUCCCUAUAGCAAA-3’) were transfected using Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075). Assays were normally carried out 48 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... CCDC15 was depleted using an siRNA with sequence 5′-GCAGUACCUGAGACAUAGAtt-3′ (Ambion, Cat. # s36888). For depletion of POC5 ...
-
bioRxiv - Biophysics 2023Quote: ... 2’(3’)-O-(2,4,6-trinitrophenyl)-adenosine 5’-triphosphate (TNP-ATP) was purchased from Invitrogen as a trisodium salt and stored in the dark at -20 °C at 10 mg/ml_ ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-5 days as necessary using 0.5mM EDTA (Thermo Fisher). All staining and qPCR experiments included in Figure 1 were carried out in H1 and H9 stem cells ...
-
bioRxiv - Developmental Biology 2023Quote: ... 5’ TCTTGCGGCTTTGTTGACAC 3’) using SYBR™ Green PCR Master Mix (Applied Biosystems, Bedford, MA). The quantities measured by real-time PCR were normalized to the Rpl13 (5’GGCGGACCGATTCAATAAGGTTCTGATCATTG 3’ ...
-
bioRxiv - Cell Biology 2023Quote: ... The following siRNA target sequences were used: GTPBP5 siRNA: 5’-CGGUGGACACGUCAUUCUGTT-3’ (134621, Ambion); GTPBP7 siRNA ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae at 5 dpf were incubated in 3 µM FM 1-43 (Thermofisher, T3163) in E3 media for 35 s ...
-
bioRxiv - Biochemistry 2021Quote: ... Stained ovaries were finally mounted with one drop of vectashield in epoxy diagnostic slides (Thermo-Fisher Scientific, 3 wells 14 mm) and covered with high precision cover glasses ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Microbiology 2024Quote: ... isolated RNA was run using a TaqMan Fast Virus One-Step Master Mix (applied Biosystems) on a QuantStudio 3 Flex Real-Time PCR system (Applied Biosystems). RNA standards with known copy numbers were used to generate a standard curve and calculate sample copy numbers ...
-
bioRxiv - Molecular Biology 2022Quote: ... and modified pLX301 vectors 9 containing either a siRNA-resistant version of HA-NOL7 CDS or empty vector in a 1:9:10 ratio (1 μg:9 μg:10 μg for a 10-cm plate) with Lipofectamine 2000 (Life Technologies, 11668019) per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C in a 5% CO2 incubator with daily media changes and were passaged every 4-5 days using TrypLETM (ThermoFisher), following manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2021Quote: ... and one-fifth of the affinity purification (IP) were separated on Bolt 4-12% Bis-Tris Plus 15-well gels (Invitrogen), run in Bolt 1x MOPS SDS running buffer (Novex ...
-
bioRxiv - Microbiology 2021Quote: ... Genomic DNA was eliminated from RNA extracts by digesting for one hour at 37°C with 4 U of TURBO DNAase (Ambion) followed by purification with MEGAclear Transcription Clean-Up kits (Ambion).
-
bioRxiv - Microbiology 2021Quote: ... Protein purity was determined by resolving one to two micrograms of purified protein by SDS-PAGE using NuPAGE 4–12 % Bis Tris precast gels (ThermoFisher) for 50 minutes at 200 V ...
-
bioRxiv - Genomics 2022Quote: ... We estimated DNA quality using a NanoDrop One Microvolume UV-Vis Spectrophotometer and quantified DNA using a Qubit 4 Fluorometer (ThermoFisher) with a Quant-iT dsDNA HS Assay Kit ...