Labshake search
Citations for Thermo Fisher :
1451 - 1500 of 10000+ citations for 6 Methoxy 2 3 4 9 tetrahydro 1H b carbolin 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Laurdan (6-Dodecanoyl-2 Dimethylaminonaphthalene Thermo Fisher Scientific, MA) was dissolved in DMF (Sigma Aldrich ...
-
bioRxiv - Immunology 2022Quote: ... containing 4′,6-diamidino- 2-phenylindole (DAPI) and were transferred onto microscope slides with large-orifice 200 µL-tips (Fisher Scientific, 02707134). The following antibodies or reagents were used ...
-
bioRxiv - Neuroscience 2021Quote: ... sections were rinsed and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Cell Biology 2021Quote: ... cells were washed three times with PBS and mounted on the slide with ProLong Diamond antifade with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies, #P36966). Confocal images were acquired on a Nikon Ti-Eclipse A1M microscope fitted with a 60× oil immersion objective using 488 nm ...
-
bioRxiv - Cell Biology 2022Quote: ... Slides were washed three times and ProLong® Gold Antifade mounting reagent containing DAPI (4’,6-diamidino-2-phenylindole) (Thermo Scientific, #P10144) was applied to mount the coverslips.
-
bioRxiv - Microbiology 2021Quote: ... then 50 μl of the EV preparations were mixed with 250 μl PBS staining buffer containing 2.5 µg/ml DAPI (4’, 6-diamidino-2-phenylindole; Thermo Fisher Scientific, USA)) and kept at 4 °C for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... The cells were again washed and incubated for 10 min in a solution of 4’,6’-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific). Cells were imaged using a Leica DM IRB epifluorescence microscope ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... sections were rinsed three times for 10 min each and mounted immediately after onto glass slides coated with gelatin in Fluoromont-G with 4′,6-diamidino-2-phenylindole (DAPI) (00-4959-52, Invitrogen, Thermo Fisher Scientific) as counterstaining.
-
bioRxiv - Immunology 2020Quote: ... Isolated B cells were stained for 20 minutes on ice with a fluorescence staining-mix containing 4’,6-Diamidin-2-phenylindol (DAPI; Thermo Fisher Scientific), anti-human CD20-Alexa Fluor 700 (BD) ...
-
bioRxiv - Microbiology 2020Quote: ... Alexa-Fluor 594 labelled goat anti-rabbit IgG, ProLong Gold antifade reagent with DAPI (4’, 6-diamidino-2-phenylindole) (Life technologies-Invitrogen, USA), ATP Affinity kit (no ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with DAPI (4’,6-diamidino-2-phenylindole) and filamentous actin with Alexa Fluor 488-conjugated phalloidin (Thermo Fisher Scientific).
-
bioRxiv - Cell Biology 2022Quote: ... The coverslips were then washed with 1x PBS and incubated with μg/ml DAPI (4’,6-diamidino-2-phenylindole; Life Technologies, #D1306), followed by mounting as described above.
-
bioRxiv - Immunology 2022Quote: ... Cells were then washed with DPBS before being stained with 50 μL/well of DAPI (4’,6-diamidino-2-phenylindole, dihydrochloride) (Invitrogen, cat. #D1306) diluted to 5 μM in DPBS for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... After 2 washes with 1xPBS, the cell nuclei were stained with NucBlue Fixed Cell Stain ReadyProbes Reagent (4’,6-diamidino-2-phenylindole, DAPI) (Thermo Fisher Scientific) for 30 min in the dark at RT ...
-
bioRxiv - Neuroscience 2024Quote: ... Sciatic nerves of 6 mouse pups between postnatal days 2 and 4 (P2 and P4) were collected in L15 medium (Thermofisher, Massachusetts, USA) and incubated for 30 min in 2 mg/mL collagenase II and then 10 min in 0.25 % trypsin containing EDTA at 37 °C ...
-
bioRxiv - Physiology 2023Quote: ... the coverslips were washed with PBS three times before being mounted using ProLong™ Diamond Antifade Mountant with 4′,6-diamidino-2-phenylindole (DAPI; Life Technologies). Images were obtained with Olympus BX61 fluorescence microscope or Zeiss LSM800 laser confocal scanning microscope and processed using cellSens imaging software (Olympus ...
-
bioRxiv - Microbiology 2023Quote: ... After the secondary antibody was washed three times for 5 min, nuclei were stained with DAPI (4’,6- Diamidino-2-Phenylindole, Dihydrochloride) (#D1306, Thermo Fisher Scientific) (dilution 1:1,000 in PBS ...
-
bioRxiv - Cancer Biology 2023Quote: ... sections were stained with 4′,6-diamidino-2-phenylindole (DAPI) for 10 min and mounted using SlowFade Diamond Antifade Mountant with DAPI (Invitrogen, Cat# S36964). Slides were imaged using a Nikon Y-FL microscope attached to a Nikon DS-Qi2 camera and images were captured using NIS elements AR software ...
-
bioRxiv - Plant Biology 2023Quote: ... 250 ng/ml 4′,6-diamidino-2′-phenylindole dihydrochloride (DAPI) or 500 nM SYTOX Orange (Life Technologies, Thermo Fisher Scientific, Schwerte, Germany) were used as nucleic acid stain.
-
bioRxiv - Microbiology 2022Quote: ... in PBS prior to staining with DAPI (4=,6-diamidino-2-phenylindole) and mounted in Prolong Diamond antifade (Molecular Probes, Life Technologies). Images were captured using a Nikon Eclipse Ti confocal microscope (Nikon Instruments ...
-
bioRxiv - Microbiology 2023Quote: ... Fixed cells were stained with 4’,6-diamidino-2-phenylindole (DAPI) for visualization of host-cell nuclei and anti-MOMP antibody conjugated to FITC (Thermo Scientific™) for visualization of Chlamydia ...
-
bioRxiv - Genomics 2023Quote: ... nuclei were counterstained with ProLong Gold anti-fade reagent with 4’,6-diami-dino-2-phenylindole (DAPI) (Life Technologies, catalog no. P36935). Images were viewed on a Zeiss Axioskop 2 using AxioVision Rel ...
-
bioRxiv - Bioengineering 2023Quote: ... The slides were thoroughly rinsed and sealed utilizing a SlowFade Gold antifade reagent with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Thermo Fisher Scientific) and coverslips.44 The stained slides were imaged at 4x magnification with an EVOS fluorescence imaging system.
-
bioRxiv - Microbiology 2024Quote: ... The coupon was incubated in a 300 nM (100 ng/mL) solution of DAPI (4’,6-diamidino-2-phenylindole, ThermoFisher, Waltham, MA) for 3 minutes as per the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... sections were incubated for 5 min with 4’,6-diamidino-2-phenylindole, dihydrochloride (DAPI, Dojindo, D523) and then mounted with PermaFluor (Thermo Fisher Scientific). Images were acquired using a BC43 or LSM800 instrument equipped with a Zeiss Axio Observer Z1 and a LSM 800 confocal unit with Airyscan module ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were co-stained with Draq5 (Cell Signal, 4048L) or nuclei stain 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI; Thermo Fisher, D1306). Stained samples were imaged using an Olympus FV3000 Confocal Laser Scanning Microscope.
-
bioRxiv - Neuroscience 2021Quote: ... Cells were then washed 3× with PBS and incubated for 1h with the corresponding Alexa Fluor secondary antibodies (Thermo Fisher Scientific) at 1:1000 dilution (in 3% BSA ...
-
bioRxiv - Biochemistry 2023Quote: ... 4 mM Mg(OAc)2 (Invitrogen), 0.55 mM spermidine (Sigma) ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Neuroscience 2024Quote: ... with 2% heat-inactivated FBS Certified One Shot (Gibco, A38400-01) and 1x N-2 supplement (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... third instar larvae were dissected in zero Ca2+ HL-3 solution at room temperature and stimulated with a HL-3 solution of 90 mM K+/2 mM Ca2+/4 μM FM4-64 (Invitrogen) for 5 min to load FM4-64 dye into the boutons ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were treated with RNAScope H2O2 for 4 min at RT and subsequently washed 2 x 3 min with UltraPure Distilled Water (Invitrogen) at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... were crossed for 2-3 days and then transferred to fly food made from 0.6 g of Carolina Formula 4-24 (Fisher Scientific) and 2 mL of ddH2O ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Developmental Biology 2019Quote: ... One-third to one embryo equivalents were loaded at per lane on 4%-12% or 8% Bolt® Bis-Tris (Invitrogen). GFP Rabbit IgG Polyclonal Antibody (Molecular Probes ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 ng Cholera Toxin subunit B (CT-B) (Recombinant Alexa Fluor 488 conjugate, Life Technologies) was injected into the hindbrain ventricle81 ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2024Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2 mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...