Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Zika Virus DIII Envelope Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2019Quote: ... and Moloney murine leukemia virus reverse-transcriptase (MMLV-RT, Invitrogen). Subsequent PCR amplification performed in a thermocycler using specific primers ...
-
bioRxiv - Genetics 2020Quote: Fibroblasts were infected by Sendai virus(Thermo Fisher Scientific, A16517) Transfected fibroblasts (approximately 1*105 cells per nucleofection ...
-
bioRxiv - Microbiology 2021Quote: ... 7μl of 4x Taqman Fast Virus Master Mix (Thermo Fisher), 5μl of DNAse/RNAse free water and 3μl of primers and probe mix (sequences shown in Table 1) ...
-
bioRxiv - Immunology 2020Quote: ... the virus inoculum was replaced with fresh medium (MEM, Gibco) containing 1.25% Avicel® (FMC Biopolymer ...
-
bioRxiv - Immunology 2021Quote: ... Virus was diluted in Dulbecco’s Modified Eagle Medium (DMEM, Gibco) and maintained on ice prior to infection ...
-
bioRxiv - Immunology 2022Quote: ... Virus stocks were diluted into supplemented media (DMEM from Gibco, Cat ...
-
bioRxiv - Immunology 2022Quote: ... Virus stocks were diluted into supplemented media (DMEM from Gibco, Cat ...
-
bioRxiv - Molecular Biology 2023Quote: ... and virus amplification in Spodopetera frugiperda 9 (Sf9) cells (ThermoFisher) was performed using standard procedures and as described in Zeqiraj et al ...
-
bioRxiv - Immunology 2023Quote: ... TaqMan Fast Virus 1-step Master Mix (Thermo Fisher Scientific), primers ...
-
bioRxiv - Neuroscience 2023Quote: ... and Moloney murine leukemia virus (M-MLV) Reverse Transcriptase (Invitrogen). One microgram of total RNA was retrotranscribed and the cDNA was diluted 1:10 to the quantitative PCR (qPCR) ...
-
bioRxiv - Immunology 2024Quote: ... Virus inoculum was prepared in DMEM (Thermo Fisher Scientific, 119905040) supplemented with 2% FBS and allowed for 1 hour at 37°C for virus adsorption onto cells ...
-
bioRxiv - Immunology 2024Quote: ... Antibodies used: anti-Influenza A virus NS1 (PA5-32243, ThermoFisher), anti-acetyl-α-tubulin (Ly640 ...
-
bioRxiv - Microbiology 2022Quote: ... envelope plasmid (0.9 µg pMD2.G) and pLX304 carrying eGFP-LC3B (9 µg) using Opti-MEM (Fisher Scientific) and FuGENE HD transfection reagent (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... 6ug of psPAX2 viral packaging vector and 3ug pMD2.G viral envelope vector overnight with Lipofectamine 3000 (Invitrogen) according to manufacturer protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Cell envelopes were stained by adding 5 µL of 1 mg/mL FM™ 4-64FX (Thermo Fisher Scientific) and non-viable cells stained with 1 µL of the LIVE/DEAD™ cell dye (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... shRNA plasmids were co-transfected into HEK293TD cells along with packaging (Δ8.9) and envelope (VSVG) expression plasmids using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2019Quote: ... 3 μg guide RNA plasmid was cotranfected into 5 × 106 HEK293T cells with 3 μmg psPAX2 packaging vector and 1.5 μg pMD2.G VSV-G envelope vector using lipofectamine 2000 (Invitrogen). Supernatants were harvested over 72 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... and 2.16 μg of the vector expressing the VSV-G envelope glycoprotein (pMD2.G) were mixed with OptiMEM (Gibco) to a final volume of 400 μl ...
-
bioRxiv - Bioengineering 2022Quote: ... packaging coding vector (pCMVdR8.74) and envelope coding vector (pMD2.G)) was diluted in 250 µL Opti-MEM (Invitrogen, Germany) and 11.25 µL of polyethyleneimine (1 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... shRNA plasmids were co-transfected into HEK293TD cells along with packaging (Δ8.9) and envelope (VSVG) expression plasmids using the Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 µg packaging plasmid (psPAX2) and 2.5 µg envelope plasmid (pMD2.G) using Lipofectamine 2000 in OptiMEM (ThermoFisher Scientific). After 6-hr incubation of Lipofectamine/DNA mixture in OptiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... and envelope (pMD2.G; 0.5 µg) plasmids using either FuGENE 6 or Lipofectamine 3000 transfection reagent (both from Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2.84 μg of pCMV-VSV-G envelope plasmid, 5.67 μg of pCMV dR8.2 dvpr packaging plasmid in OptiMEM medium, Gibco #31985062) and 1 ml of premix 2 (42.5 μl of Lipofectamine LTX ...
-
bioRxiv - Microbiology 2021Quote: ... virus stocks were prepared in serum-free VP-SF media (Invitrogen). Viruses were harvested before CPE development ...
-
bioRxiv - Cell Biology 2021Quote: ... The virus packaging was performed in HEK293FT cells (Thermo Fisher Scientific) based on a calcium precipitation method using pUMVC and pCMV-VSV-G vectors (37 ...
-
bioRxiv - Immunology 2021Quote: ... Virus particles in 2% FBS/DMEM/1mM Pen/Strep (Thermofisher, 15140122) were incubated with cells for 2 hours at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the TaqMan Fast Virus 1-Step Master Mix (Applied Biosystems). According to the manufacturer’s instruction (QIAamp Viral RNA mini kit (Qiagen)) ...
-
bioRxiv - Microbiology 2022Quote: ... using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems). SARS-CoV-2 genomic RNA was amplified and detected using forward (5’- CGTGTAGTCTTTAATGGTGTTTCC-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... cells and purified virus particles were lysed with RIPA (ThermoFisher Scientific) buffer supplemented with complete protease inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2020Quote: ... TaqMan™ Fast Virus 1-Step Master Mix (4444432, Life Technologies) was used for one-step RT-qPCR and TaqMan Fast Advanced Master Mix (4444556 ...
-
bioRxiv - Microbiology 2020Quote: ... Virus stocks were treated with 40 U/mL DNase I (Invitrogen) for 1 hr at 37°C before they were used to infect cells for 2 hr at an MOI of 0.5-2 ...
-
bioRxiv - Physiology 2022Quote: ... and 200 U of Moloney murine leukemia virus reverse transcriptase (Invitrogen) in a final reaction volume of 20 μL (Evans-Molina et al. ...
-
bioRxiv - Microbiology 2020Quote: ... using TaqMan Fast Virus 1-Step Master Mix chemistry (Applied Biosystems). SARS-CoV-2 N gene RNA was amplified using forward (5’-GACCCCAAAATCAGCGAAAT ...
-
bioRxiv - Genetics 2020Quote: ... Cells were then transduced using CytoTune-iPS 2.0 Sendai virus (Invitrogen) as outlined in the supplier’s protocol at an MOI of 5:5:3 (KOS [Klf4 ...
-
bioRxiv - Microbiology 2021Quote: Virus replication assays were performed in RPMI 1640 (Gibco 11875-093) supplemented with 10% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μl of TaqMan Fast Virus 1-Step Master Mix (ThermoFisher), and 9 μl of molecular-grade water per reaction ...
-
bioRxiv - Immunology 2023Quote: ... Taqman Fast Virus 1-step kit (Thermo Fisher; catalog number 4444434) with oligos and probe specific to the N gene of SARS-CoV2 was used for SARS-CoV-2 RNA detection according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... TaqMan Fast Virus 1-Step Master Mix (ThermoFisher, Cat No. 5555532) and a commercially prepared RNAse P primer/probe combination (IDT ...
-
bioRxiv - Biochemistry 2023Quote: ... virus inoculum was exchanged with serum-free MEM (Gibco, Life Technologies) containing 0.75% carboxymethylcellulose (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... virus inoculum was exchanged with serum-free MEM (Gibco, Life Technologies) containing 0.75% carboxymethylcellulose (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... dNTP and Moloney murine leukemia virus (M-MLV) reverse transcriptase (Invitrogen) were used to synthesize cDNA ...
-
bioRxiv - Molecular Biology 2023Quote: Virus particles were fixed in 1 % glutaraldehyde (Cat# 233281000, Thermo Scientific). A 4 µL aliquot of sample was adsorbed onto holey carbon-coated grid (Lacey ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cloned plasmids were transiently transfected into HEK293T cells with packaging plasmid psPAX2 and envelope plasmid pMD2.G using Lipofectamine 3000 transfection reagent (Invitrogen) based on the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: ... 1.5 μg psPAX2 packaging plasmid and 500 ng pMD2.G envelope plasmid were co-transfected in HEK293 FT cells in 10-cm dishes using Lipofectamine (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... the packaging construct pCMVD8.9 and the envelope coding plasmid pCMV-VSVG (from Dr. Soosan Ghazizadeh, SUNY Stony Brook) into 293T cells using lipofectamine 2000 (Invitrogen). Supernatant containing the virus was collected after 72 hours and filtered through a 0.22 micron PES (Millipore ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed and then stained with HERV-K envelope primary antibodies (1:1000) (Ango) overnight at 4°C and Alexa Fluor 488 secondary antibodies (1:500) (Invitrogen) for 1 h at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... 293GP cells were then transfected with 6 μg of a candidate TCR pMSGV1-plasmid in the presence of the 3 μg of RD114 envelope using Lipofectamine 3000 (Invitrogen). The pMSGV1-plasmid and RD114 were obtained through an MTA from S ...
-
bioRxiv - Microbiology 2022Quote: ... Viral stock was generated by co-transfecting HEK 293T cells with 10:1 ratio of HIVGKO plasmid and a plasmid encoding VSV-G envelope using Lipofectamine 3000 reagent (Invitrogen). Culture supernatant was harvested 48hrs post-transfection ...
-
Zero-shot learning enables instant denoising and super-resolution in optical fluorescence microscopybioRxiv - Bioengineering 2023Quote: ... together with psPAX2 packaging and pMD2.G envelope plasmid DNA were co-transfected to HEK293T cells using Lipofectamine 3000 (Invitrogen) following the manufacturer’s protocol ...