Labshake search
Citations for Thermo Fisher :
101 - 150 of 1635 citations for Benzo Ghi Perylene D12 98% 97% Chemical Purity since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... at 98°C for 20 min using a Lab Vision Pretreatment Module™ (Thermo Scientific). After permeabilization with PBS/0.3% Triton-X100 for 5 min ...
-
bioRxiv - Microbiology 2022Quote: ... Ammonium acetate (≥98%, Optima LC/MS) was purchased from Fisher Scientific (Fair Lawn, NJ, USA). Water was purified by a Milli-Q system (resistivity 18.2 MΩ cm at 25°C ...
-
bioRxiv - Microbiology 2019Quote: ... DNA quantity and purity were determined with NanoDrop (ThermoFisher, USA) by measuring 260/280 absorbance ratios ...
-
bioRxiv - Genomics 2020Quote: ... and purity was assessed using a Nanodrop (Thermo Fisher Scientific). The Fragment Analyzer (AATI ...
-
bioRxiv - Evolutionary Biology 2022Quote: DNA purity was determined with Nanodrop (Thermo Fisher Scientific, USA) to measure A260/280 and A260/230 ratios ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA concentration and purity were measured by NanoDrop (Thermo Fisher) spectrophotometer ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA concentration and purity was analyzed by Qubit Fluorometer (Invitrogen) and Agilent Bioanalyzer 2100 ...
-
bioRxiv - Genomics 2022Quote: ... DNA purity was evaluated using Nanodrop 2000 (Thermo Fisher Scientific) UV/Vis measurements ...
-
bioRxiv - Microbiology 2019Quote: ... Purity was determined by Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific), and concentration was determined by Qubit 3.0 fluorometer (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2019Quote: ... RNA purity was verified using Nanodrop 2000 spectrophotometer (Thermo Scientific).
-
bioRxiv - Molecular Biology 2019Quote: ... DNA quantity and purity was determined with NanoDrop (ThermoFisher, USA) by measuring 260/280 absorbance ratios ...
-
bioRxiv - Immunology 2021Quote: ... RNA concentration and purity were determined by NanoDrop (Thermo Scientific) to confirm an A260:A280 ratio above 1.9 ...
-
bioRxiv - Plant Biology 2020Quote: ... DNA purity was assessed using a NanoDrop 2000 (Thermofisher Scientific) and quantified fluorometrically using the Quant-iTTM assay kit (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... Protein purity was checked on a Sypro (Thermo Fisher Scientific) stained SDS-PAGE gel.
-
bioRxiv - Microbiology 2021Quote: ... Purity of the samples was assessed using NanoDrop (Thermo Fisher) and DNA quantification performed using a Qubit High Sensitivity DNA assay (Life Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and assessed for purity by NanoDrop 8000 Spectrophotometer (Thermo Scientific) 260/280 absorbance ratio measurements ...
-
bioRxiv - Microbiology 2022Quote: ... and purity was calculated using a NanoDrop One (Thermo Fisher). Genomic DNA samples (3 µg ...
-
bioRxiv - Microbiology 2022Quote: ... DNA purity was determined on the Nanodrop One (ThermoFisher Scientific) and quantified on the Qubit dsDNA fluorometer ...
-
bioRxiv - Microbiology 2022Quote: ... RNA concentration and purity was assessed using Nanodrop 2000 (ThermoFisher). Residual genomic DNA was removed using Turbo DNase (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... RNA purity was analyzed with a NanoDrop 2000 (ThermoFisher Scientific). A 25 μl RT-PCR for the viral E gene was carried out using 5 μl of extracted RNA template using the AgPath-ID One-Step RT-PCR (Applied Biosystems) ...
-
bioRxiv - Physiology 2021Quote: ... RNA purity was determined using a Nanodrop ONEC (Thermo Scientific). cDNA was generated with the iScriptTM cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Cancer Biology 2021Quote: ... and assessed for purity by NanoDrop (Thermo Scientific, MA, USA) 260/280 and 260/230 ratio measurements ...
-
bioRxiv - Cancer Biology 2019Quote: ... and assessed for purity by NanoDrop (Thermo Scientific, MA, USA) 260/280 and 260/230 ratio measurements ...
-
bioRxiv - Microbiology 2021Quote: ... DNA concentration and purity was measured by NanoDrop spectrophotometer (Thermofisher).
-
bioRxiv - Molecular Biology 2021Quote: ... RNA concentration and purity was determined using nanodrop 1 (ThermoFisher). RNA integrity was analyzed using Agilent Bioanalyzer 2100 and Agilent’s RNA 6000 nano kit (Cat# 5067-1511) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA purity and concentration were measured using a Nanodrop (ThermoFisher). The K ...
-
bioRxiv - Microbiology 2020Quote: ... RNA purity and concentration was confirmed using a Nanodrop (ThermoFisher). rtQPCR was performed (Applied BioSystems 7500 ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA concentration and purity were measured by NanoDrop (Thermo Fisher).
-
bioRxiv - Neuroscience 2023Quote: ... RNA purity was measured at a NanoDrop Spectrophotometer (ThermoFisher Scientific) and RNA integrity was assessed using the RNA 6000 Nano Kit on a Bioanalyzer (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... and purity checked using the NanoDrop Lite Spectrophotometer (Thermo Scientific). Using High-Capacity RNA-to-cDNA Kit (Thermo Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... and the purity was analyzed by SDS-PAGE (Invitrogen, WG1203BOX).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA concentration and purity was assessed by NanoDrop 2000 (ThermoFisher). RNA samples were stored at −80°C freezer and subsequently shipped on dry ice to Genewiz (Azenta US ...
-
bioRxiv - Genetics 2023Quote: ... Purity was determined using a NanoDrop spectrophotometer (Thermo Scientific, USA) and DNA quantification was performed using a Qubit® 2.0 fluorometer (Life Technologies) ...
-
bioRxiv - Neuroscience 2023Quote: ... high-purity heavy isotope-labelled peptides (AQUA Ultimate, Thermofisher Scientific) from proteins that exhibited significant abundance difference between the groups in the first PRM assay were spiked in the digested CSF samples at optimal dilutions ...
-
bioRxiv - Physiology 2024Quote: RNA purity was determined using a Nanodrop ONEC (Thermo Scientific). cDNA was generated with the iScriptTM cDNA Synthesis Kit (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... RNA purity was measured using a Nanodrop instrument (Thermo Scientific) at A260/280 ratio ...
-
bioRxiv - Microbiology 2023Quote: ... RNA concentration and purity were measured on a Nanodrop (ThermoFisher). In new microcentrifuge tubes ...
-
bioRxiv - Microbiology 2021Quote: ... a 97 nucleotide fragment of the spike ORF was cloned into the pJET1.2 vector (Invitrogen). Following linearization with HindIII ...
-
bioRxiv - Neuroscience 2022Quote: ... prepared according to manufacturer’s specifications with 97 mL of Neurobasal® Medium (Gibco®, 21103), 2 mL of B-27® Serum-Free Supplement (Gibco® ...
-
bioRxiv - Systems Biology 2019Quote: ... The column was washed for a further 3 min with 98% acetonitrile (Optima grade, Fisher Scientific) with 0.1% formic acid and finally equilibrated with 0.1% B for 1.5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... Samples were denatured at 98°C for 15 min in 1x SDS sample buffer (Life Technologies) and separated via electrophoresis through 12% Tris-glycine polyacrylamide gels (Nupage ...
-
bioRxiv - Plant Biology 2022Quote: The stock solutions for the GLVs (Z)-3-hexen-1-ol (Z3-HOL, 98%; Acros Organics) and (Z)-3-hexenyl acetate (Z3-HAC ...
-
bioRxiv - Cancer Biology 2024Quote: ... 99+% (Thermo Scientific Chemicals). Immediately following stimulation ...
-
bioRxiv - Genomics 2022Quote: ... 97 Samples were measured using a Q Exactive Plus Orbitrap LC–MS/MS System (Thermo Fisher). For each sample ...
-
bioRxiv - Cell Biology 2022Quote: ... or siRNAs against mouse Adgrg6 (MSS278013: #13 CGACUGCCAAGGGCCUGUCAUUUAA MSS210995: #95 GCCUCCAAAUUUGCUUGAGAAUUUA; MSS210997: #97 CCGUGUUACCCUAAUGACUACCCUA, ThermoFisher Scientific). Transfection was performed using Lipofectamine 2000 (LS11668019 ...
-
bioRxiv - Cell Biology 2020Quote: ... BMECs were sorted to purity into TRIzol LS Reagent (ThermoFisher Scientific). RNA was purified from TRIzol LS according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... Concentration and purity were recorded on a NanoDrop 1000 (Thermo Fisher). All constructs were confirmed by DNA sequencing and protein expression before use.
-
bioRxiv - Molecular Biology 2021Quote: ... RNA concentration and purity were determined (Nanodrop 1000 spectrophotometer, Thermo Fisher). Ten nanograms of RNA was treated with DNase I to remove residual DNA then converted to cDNA by Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... DNA concentration and purity were measured with a Qubit 3 (Invitrogen) and Nanodrop ND-1000 (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2020Quote: ... Purity and quantification of mRNA were determined via NanoDrop (Thermo Scientific) and a Qubit RNA HS Assay kit (Thermo Scientific).