Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 3S 4S tert Butyl4 furan 3 yl 3 hydroxypiperidine 1 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Lipofectamine RNAiMAX (Thermo Scientific, 13778030, 1:3), FuGene HD (Promega ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... ToPro-3 1:1000 and TMRM 1:100,000 (Invitrogen) added and incubated for 10 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Systems Biology 2023Quote: ... A600 was measured on a BioMate 3S spectrophotometer (Thermo Scientific). For experiments with S ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...
-
bioRxiv - Neuroscience 2024Quote: Rabbit monoclonal or polyclonal antibodies include those against 14-3-3 (Invitrogen, 51-0700, 1:1000); clathrin heavy chain (Abcam ...
-
bioRxiv - Neuroscience 2024Quote: ... NIM was replaced to 3:1-medium consisting of 3 parts DMEM (Thermo Fisher Scientific, #31966047) and one-part F12 medium (Ham’s F-12 Nutrient Mix ...
-
bioRxiv - Developmental Biology 2024Quote: 3 dpf larvae were incubated in 3 µM FM™ 1-43 Dye (Thermofisher catalog # T3163) for 2-4 minutes ...
-
bioRxiv - Biophysics 2023Quote: ... Sulfosuccinimidyl 4-(N-maleimidomethyl)cyclohexane-1-carboxylate (Thermo Fisher, A39268) (Sulfo-SMCC ...
-
bioRxiv - Microbiology 2023Quote: ... FluoSpheres™ carboxylate beads (1 µm, red 580/605, Invitrogen) were added apically and allowed to sediment on the tissue for 5 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 1 µm fluorescent beads (FluoSpheres Carboxylate-Modified Microspheres, F8823, Invitrogen) were suspended in deionized water and added onto a glass coverslip and sealed with nail polish.
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Neuroscience 2022Quote: ... NIM was exchanged daily for 3:1-DMEM/F12-medium (3 parts DMEM (Thermo Fisher Scientific, #31966047) and one-part F12 medium (Ham’s F-12 Nutrient Mix ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Genetics 2021Quote: ... 8ul of 1:3 Vectashield (Thermo Fisher Scientific) DAPI:PBS was added to samples and allowed to incubate for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... 1× 10−3 М glutamine (Gibco, Cat:25030149) and 2 mg/ml gentamicin (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... in 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TO-PRO-3 (Thermo Fisher T3605, 1:10,000) to label dead cells ...
-
bioRxiv - Neuroscience 2021Quote: ... the DNA dye TOPRO-3 (1:1000, Invitrogen), diluted in a blocking buffer for 2 h at 24 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... pan-cytokeratin (ThermoFisher, 3-9003-82, 1/50), pSmad1/5/8 (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... then washed 3 times with 1×PBS (Invitrogen). Roots were then squashed under coverslips onto slides that had been pre-treated with 3-Aminopropylthiethoxysilane (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) donkey anti-rabbit 488 (1:250, Invitrogen). To visualize immunofluorescence ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-V5 (Invitrogen, #R96025, 1:800, 3 days), anti-cFOS (Abcam ...
-
bioRxiv - Immunology 2024Quote: ... rabbit anti-caspase 3 (710431, Invitrogen, 1:100), rabbit anti-PDL1 (GTx57193 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were assayed using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (5,000 cell/well) ...
-
bioRxiv - Cancer Biology 2021Quote: Relative cell proliferation rates were determined using an MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay kit (Vybrant™ MTT Cell Proliferation Assay Kit, Invitrogen™, Thermo Fisher Scientific, cat. no. V13154). Cells were plated in triplicate in a 96-well plate (3,000 cell/well in 200 μL of complete medium and cultured under standard conditions for 48 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Immunology 2024Quote: ... slides were washed with 1:3 diluted blocking buffer (3-times, 1 minute) and incubated with anti-mouse Alexa fluor-594 antibody (Invitrogen, A21203), anti-rabbit Alexa fluor-750 (Invitrogen ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Bioengineering 2024Quote: ... EDC (1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride) and Sulfo-NHS (N-hydroxysulfosuccinimide) were purchased from ThermoFisher (USA). Unless otherwise stated all other chemicals were received from Sigma (St Louis ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...