Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 3S 4S tert Butyl4 furan 3 yl 3 hydroxypiperidine 1 carboxylate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Cell Biology 2023Quote: ... 5’-GAGACCCUAUCCGUGAUUAtt-3’ and antisense: 5’- UAAUCACGGAUAGGGUCUCtt-3’ (Silencer Select, rat negative control #1; scrambled siRNA and all siRNAs were from Ambion, Life Technologies). Transfection complexes were prepared in accordance with the instructions provided by the manufacturer and added to 2×105 cells seeded per well in 24-well plates.
-
bioRxiv - Immunology 2024Quote: ... and activated by adding 50 mg/ml sulfo-NHS (N-hydroxysulfosuccinimide) and EDC [1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride] (Thermo Fisher Scientific). Each bead region was then incubated with 6.25 μg of the respective antigen yielding a final concentration of 6.25μg antigen/1 × 10^6 beads in coupling buffer [0.5 M 2-(N-morpholino ...
-
bioRxiv - Microbiology 2024Quote: ... Serum samples were assayed at 3-fold dilutions starting at a 1:3 dilution in Blocker Casein in PBS (Thermo Fisher Scientific) diluent ...
-
bioRxiv - Developmental Biology 2024Quote: ... followed by transfer to a positively charged nylon membrane and then crosslinked with EDC (1-Ethyl-3-(3-dimethylaminopropyl)carbodiimide) at 60°C for 1–2 hours and prehybridized with ULTRAhyb Ultrasensitive Hybridization Buffer (Invitrogen, cat # AM8670). The membrane was then hybridized with 50 pmol mL−1 Biotin-labeled Locked Nucleic Acid-modified DNA probes (designed and synthesized by Qiagen ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μl were sampled on a 3 well Diagnostika slides (X1XER303B) from Thermo scientific for observation on an Zeiss LSM710 confocal microscope equipped with a Plan-Apochromat 63×/1.4 Oil objective and 405 nm and 488 nm lasers ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 μg DNA and 3 μL Lipofectamine in 300 μl Optimem (Thermofisher Scientific, USA) were used per well containing 700 μl DMEM ...
-
bioRxiv - Neuroscience 2024Quote: ... wells were treated with Caspase-3/7 (CellEvent™ Caspase-3/7 Green, Invitrogen) 1:1000 in treatment media ...
-
bioRxiv - Microbiology 2023Quote: ... 3′RNA-seq libraries were analyzed on a Qubit 3 Fluorometer (Thermo Fisher Scientific) and an Agilent 4200 TapeStation System prior to paired- end sequencing using the HiSeq 2500 system (Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Neuroscience 2024Quote: ... 3 mg of solid red DiI (1,1’-dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, Molecular Probes) dissolved in methylene chloride were mixed with 50 mg of tungsten beads (1.3 microns in diameter ...
-
bioRxiv - Cell Biology 2020Quote: ... in a 3:1 ratio with 1X penicillin/streptomycin (Gibco; 15070) and 5% FBS (Gibco ...
-
bioRxiv - Neuroscience 2021Quote: ... rat Taste receptor type 1 member 3 (Tas1r3, Rn00590759_g1, Applied Biosystems) and rat Taste receptor ...
-
bioRxiv - Cell Biology 2020Quote: ... and washed 3 times with 1x PBS (Fisher Scientific, BP399-1).
-
bioRxiv - Microbiology 2020Quote: ... and anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (1:5,000 dilution, Invitrogen). Secondary antibodies against rabbit and mouse IgG conjugated to IRDye 680LT or IRDye 800CW were obtained from Li-Cor (1:10,000 dilution) ...
-
bioRxiv - Cancer Biology 2022Quote: ... BxPC-3 and PSN-1 were cultured in RPMI1640 (Thermo Fisher), supplemented with 10% FCS and 1% P/S ...
-
bioRxiv - Microbiology 2022Quote: ... 1 nM TO-PRO™-3 Iodide (642/661 nm, Thermofisher) and 8 ng/ml calcofluor-white (CW ...
-
bioRxiv - Microbiology 2022Quote: ... 1 nM TO-PRO™-3 Iodide (642/661 nm, Thermofisher) and 8 ng/ml calcofluor-white (CW ...
-
bioRxiv - Developmental Biology 2020Quote: ... Cells were collected into FAD media (DMEM/F12 3:1 (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Genomics 2021Quote: ... for RPE1] in 1:3 ratio in Opti-MEM media (Gibco), incubated for 15 min at RT ...
-
bioRxiv - Neuroscience 2022Quote: Neurons were transfected at DIV 1-3 using Lipofectamine 2000 (Invitrogen). For one Ø18-mm coverslip seeded with 100,000 neurons ...
-
bioRxiv - Immunology 2021Quote: ... and goat anti-mouse Cyanine 3 (Life technologies, A10521, 1:1000). Images for BrdU staining were taken using a Zeiss Confocal (LSM710 META) ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μl of DNA ladder (1 Kb Plus DNA Ladder; Invitrogen), 6 μl of positive control and 10μl of template DNA were ran on 2.5% (w/v ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Genomics 2022Quote: ... at a 1:3 ratio in Opti-MEM medium (Gibco, 11524456), incubated for 15 minutes at room temperature and added dropwise to the cells ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-14-3-3γ 1:2000 (Thermo fisher PA5-29690) and mouse anti-GAPDH (CSB-MA000195 ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 3 µg ml-1 of streptavidin (Thermo Fisher) diluted in carbonate-bicarbonate buffer (E107 ...
-
bioRxiv - Developmental Biology 2024Quote: ... DNA was labeled with ToPro-3 (1:5000; Invitrogen, Cat #T3605) in 0.3% PBST for 30 min at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Physiology 2023Quote: ... counterstained with 1:30,000 TO-PRO-3 Iodide (Life Technologies, T3605), and then mounted in SlowFade Diamond mounting medium (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Cy-3 conjugated anti-rabbit secondary antibody (Invitrogen, 1:300 dilution) was added and incubated for 0.5 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 μM FluoZin-3 tetrapotassium salt (Thermo Fisher Scientific, Waltham, MA) was then added to each reaction ...
-
bioRxiv - Cell Biology 2022Quote: ... Incubation with TO-PRO-3 (1:100, ThermoFisher Scientific Ref. T3605) was performed along with secondary antibody incubation to stain nucleic acid ...
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...
-
bioRxiv - Neuroscience 2024Quote: ... larvae were immersed in 3 µM FM 1-43FX (ThermoFisher, F25255) in E3 for 30 s ...
-
bioRxiv - Cancer Biology 2024Quote: ... PMD2.G at 3:2:1 using Lipofectamine 2000 (Invitrogen, USA). The viral particles were harvested 48 and 72 hrs post-transfection and filtered through a 0.45µm filter ...
-
bioRxiv - Cancer Biology 2024Quote: ... KTB cells were maintained in 1:3 DMEM-low glucose (Gibco) with 25 mM HEPES (Sigma-Aldrich ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Immunology 2021Quote: ... 3 μM Hoechst (Life Technologies) was added to each well to stain nuclei for cell counting ...
-
bioRxiv - Genomics 2021Quote: ... 3 mL (Thermo Fisher Scientific) overnight at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 washes 5x SSCT (ThermoFisher Scientific 15557044 ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 3% FBS (Gibco) and 100 U/mL penicillin-streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2020Quote: ... cleaved-caspase-3 (9H19L2-Invitrogen); TH (AB152-Merck Millipore) ...