Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 6568 citations for ST2 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... IL-2 Human Uncoated ELISA kit and IFNγ Human Uncoated ELISA kit (both from Invitrogen) and DuoSet Human IFN-gamma kit and Ancillary Reagent Kit 2 (R&D Systems ...
-
bioRxiv - Immunology 2022Quote: ... rat anti-human (16G6) and rabbit anti-human polyclonal CD49a were all purchased from ThermoFisher. For collagen measurements 10 mg of allograft tissue/sample was analyzed with a Hydroxyproline Assay Kit (Sigma ...
-
bioRxiv - Pathology 2022Quote: ... Aβ42 human ultrasensitive ELISA Kit and Tau (phospho) [pT231] human ELISA Kit from Thermo Fisher, and sAPPα and sAPPβ ELISA Kit from Mybiosource ...
-
bioRxiv - Genomics 2021Quote: ... surviving human leucocytes in thawed samples were removed using anti-human CD45 DynaBeads (ThermoFisher Scientific). The resulting parasite pellet was washed to remove soluble human DNA (hDNA) ...
-
bioRxiv - Genomics 2022Quote: Human total RNA was extracted from THP-1 human cells using TRIzol (ThermoFisher, cat# 15596026) as per manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... human kinome panel (Cat # 4475388) and human stem cell openarray panel (Cat # 4475390, ThermoFisher, USA). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: ... A region spanning 2163 bps upstream from the transcription start site was PCR amplified using genomic DNA isolated from HEK293 cells with Platinum SuperFi II DNA polymerase (Thermo Fisher Scientific). The PCR product was cloned into pGL3 basic vector following conventional protocols ...
-
bioRxiv - Cell Biology 2020Quote: Samples prepared following immunoprecipitation from HEK293 MceC3XFLAG cell line were analysed by LC-MS on an Orbitrap Elite™ mass spectrometer (ThermoFisher Scientific) coupled to a Dionex Ultimate 3000 Ultra-Performance Liquid Chromatography (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 Phoenix cells were transfected with the pBabe plasmid DNA encoding for the protein of interest using Lipofectamine 3000 (Thermo Fisher Scientific) per manufacturer’s recommendation ...
-
bioRxiv - Molecular Biology 2019Quote: ... Transfection of Flp-In T-Rex HEK293 cells was carried out according to Flp-In™ T-REx™ Core Kit (Invitrogen). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: HEK293 cells were transfected with pcDNA3.1-GAS6-MycHis linearized with PvuI restriction enzyme using Lipofectamine® 2000 Transfection Reagent (Thermo Fisher Scientific), according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Biochemistry 2020Quote: pcDNA5-based constructs for the expression of C-terminally His6-PreScission protease cleavage site-2xFlag (Flag)-tagged full-length or N-terminally truncated ASCC3 variants were transfected into HEK293 Flp-In™ T-REx™ cells (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... For the preparation of the BGLF2-KO virus, HEK293/EBV(dBGLF2) cells (Konishi et al., 2018) were transfected with BZLF1 expression plasmid using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: Linearized plasmids containing the ItypOrco gene were transfected into HEK293 cells containing a tetracycline-inducible repressor (TREx) using Lipofectamine 2000 (Thermo Fisher Scientific) (Corcoran et al ...
-
bioRxiv - Microbiology 2020Quote: ... HEK293-EBV B(+/−) S13+/− cells were transfected with pCDNA3-BZLF1 and pCDNA3-BALF4 using TurboFect Transfection Reagent (Thermo Scientific, Waltham, MA, USA). Old medium was changed with fresh medium in one day post transfection ...
-
bioRxiv - Immunology 2021Quote: HEK293 adherent cells grown to a confluency of 70–90% were transfected using a Lipofectamine 3000 Reagent Kit (L3000075, Invitrogen, Waltham, MA). Transfection procedures were adapted from the product manual ...
-
bioRxiv - Microbiology 2022Quote: ... Titration of progeny viruses from all HEK293 cells was done in Vero-E6 cells cultured in 16-well chambered slides (Thermo Fisher Scientific), as described below ...
-
bioRxiv - Genetics 2022Quote: ... These plasmids were inserted into the same place in the genome using the Flp-In recombinase technology to generate Flp-In HEK293 (Thermofisher, cat. #R78007) stable cell lines ...
-
bioRxiv - Molecular Biology 2021Quote: HeLa cells and HEK293 cells (in 35-mm dishes) were transfected with 100 pmol siRNA using Lipofectamine RNAi max (Invitrogen–Thermo Fisher Scientific) according to manufacturer’s protocol ...