Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for 7 Benzyl 2 7 Diazaspiro 3.5 nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 1 mM DTT) in 7 kDa Slide-A-Lyzer MINI Dialysis Devices (ThermoFisher Scientific, 69562). Samples were placed in 400 ml high-salt buffer ...
-
bioRxiv - Cancer Biology 2023Quote: ... MCF-7 cells were cultured in RPMI 1640 with GlutaMax and 25 mM HEPES (Gibco) supplemented with 10% FCS ...
-
bioRxiv - Biophysics 2023Quote: COS-7 cells (catalog no. 100040, BNCC) were grown in DMEM (catalog no. 10569, Gibco) containing 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... Quantitative PCR was performed in a QuantStudio 7 Flex Real-Time PCR System (ThermoFisher, MA). The sequences of qPCR primers are listed in Table S6 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were stained with CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (ThermoFisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... we added 7 μL of Opti-MEM and 10 μL of lipofectamine RNAiMAX (Life technologies) diluted 1:20 in Serum Reduced Opti-MEM ...
-
bioRxiv - Bioengineering 2024Quote: ... we incubated COS-7 cells in 50 nM LysoTracker Deep Red (Thermo Fisher Scientific, L12492) for 45 min and washed them 3 times in PBS before imaging ...
-
bioRxiv - Cell Biology 2023Quote: ... Quantitative RT-PCR reactions were measured on a Viia 7 Real-Time PCR system (ThermoFisher) using Power SYBR Green (ThermoFisher ...
-
bioRxiv - Neuroscience 2023Quote: ... fragilis in stool was determined by ViiA™7 Real-Time PCR System (Life Technologies), in 10 μl volumes ...
-
bioRxiv - Cell Biology 2023Quote: For live cell TFF1-MS2 imaging MCF-7 cells were plated on glass bottom (Nunc) dishes and allowed to recover for multiple days prior to hormone depletion ...
-
bioRxiv - Developmental Biology 2024Quote: ... PCR was performed with Scientific QuantStudio 5 and 7 Real-Time PCR System (Thermo Fisher) using the DyNAmo Color Flash SYBR Green Mix (Thermo Fisher) ...
-
bioRxiv - Genetics 2023Quote: ... Fixed cell suspension was dropped onto a clean glass slide (Fisher Scientific, 12-544-7) from a height of 2-3 feet height using a glass Pasteur pipette in a room with >40% humidity ...
-
bioRxiv - Cell Biology 2023Quote: ... Data analysis was performed by ViiATM 7 v2.0 software or Copy Caller v2.1 (Applied Biosystems).
-
bioRxiv - Genomics 2023Quote: ... qPCR assays were run on a Quantstudio 7 machine (Thermo Fisher Scientific, Waltham MA, USA).
-
bioRxiv - Neuroscience 2024Quote: COS-7 cells (ATCC) were cultured in FluoroBrite Dulbecco’s modified Eagle’s medium (DMEM; GIBCO/BRL) supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... All qPCR assays were run using the ViiA 7 Real-Time PCR system (Applied Biosystems).
-
bioRxiv - Molecular Biology 2024Quote: ... female adults (7-days-old) were dissected in Schneider’s Drosophila Medium (Thermo Fisher Scientific, MA). The heart tube and the attached nephrocytes were dissected ...
-
bioRxiv - Molecular Biology 2024Quote: ... The qPCR was performed using the ABI ViiA 7 real-time PCR system (Applied Biosystems) with the following thermocycling program ...
-
bioRxiv - Molecular Biology 2024Quote: ... The reactions were performed either with a QuantStudio 7 qPCR system (Applied Biosystems, Waltham, MA) in 96-well plates or a Rotor-Gene Q (Qiagen ...
-
bioRxiv - Neuroscience 2024Quote: ... and subjected to 40x cycles on a QuantStudio 7 flex instrument (Applied Biosystems Cat# 448570): 50°C for 2min ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in phosphate-buffered saline (PBS)-/- (Life Technologies ...
-
bioRxiv - Neuroscience 2024Quote: ... Ppargc1a and Tbp (see Table 1) on a QuantStudioTM 7 Real-Time PCR System (ThermoFisher). Data were analysed using the 2-ΔΔCt method.
-
bioRxiv - Synthetic Biology 2024Quote: ... Quantitative PCR was performed on a QuantStudio 7 Flex Real-Time PCR system (Applied Biosystems). Relative gene quantification was performed using TaqMan primer probe set for LDLR (Hs01092524_m1 ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cell number was quantified at day 7 post treatment using FluoReporter (Thermo Fisher Scientific #F2962) or PrestoBlue (Thermo Fisher Scientific # A13262 ...
-
bioRxiv - Cell Biology 2024Quote: Thermocycling was performed on the QuantStudio 7 Flex Real-Time PCR machine (Applied Biosystems, UK) using TaqMan Universal PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were passaged once every 5-7 days using 0.5 mM EDTA (Life Technologies, #AM9260G) in PBS-/- (Life Technologies ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3.5% sodium bicarbonate (Gibco, 25080) and initially selected in 2μg/ml Puromycin when thawing a new vial of cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and benzyl alcohols were obtained from Acros Organics (Morris Plains, NJ). LC-MS grade acetonitrile for HPLC was obtained from EMD Chemicals USA ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Synthetic Biology 2021Quote: The cell lines SKBR3 and MCF-7 were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... U251 cells were treated with 4 uM CellEvent Caspase-3/7 green detection reagent (Molecular probes) prior to imaging ...
-
bioRxiv - Cell Biology 2019Quote: ... All TaqMan analysis was performed using an Applied Bio system’s Viia 7 instrument (Thermo-Fisher Scientific). The results were then exported ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Cells were then harvested and stained with 7-AAD viability dye and Vybrant DyeCycle Violet (Invitrogen) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: Total RNA was extracted from the cortices of 7-month-old mice using TRIzol reagent (Invitrogen) and RNeasy Mini Kit (Qiagen ...
-
bioRxiv - Biophysics 2022Quote: HeLa (ECACC 93021013) and MCF-7 (ECACC 86012803) cells were cultured in MEM Alpha medium (Gibco), with GlutaMax (no nucleosides) ...
-
bioRxiv - Immunology 2022Quote: ... Frozen tissues were sectioned at 7 μm thick using CryoStar™ NX70 Cryostat (Thermo Fisher Scientific), then fixed in acetone ...
-
bioRxiv - Immunology 2019Quote: ... cells were treated with TURBO™ DNase (12 units/10^7 cells, cat# AM2239, ThermoFisher Scientific) for 1 hour at 37°C ...
-
bioRxiv - Physiology 2019Quote: ... 7 mg of protein were incubated with 343 μM Maleimide-PEG2-biotin (Thermo Fisher Scientific, #21901BID) at room temperature for 30 minutes with agitation by precipitating the alkylated protein with 1 mL of 100% cold acetone by incubating at −20°C for 30 min ...
-
bioRxiv - Immunology 2021Quote: ... and TaqMan Primer/Probes was run on QuantStudio 7 Flex Real-Time PCR System (Thermo Fisher) with standard settings ...
-
bioRxiv - Immunology 2021Quote: ... Target cell killing was measured using CellEvent™ Caspase-3/7 Green Detection Reagent (Life Technologies) and analyzed by flow cytometry.
-
bioRxiv - Neuroscience 2020Quote: ... 9.4% (1.023 g/ml) and 7% (1.017 g/ml) OptiprepTM (1.320 g/ml) (Thermo Fisher Scientific). After centrifugation at 800 x g for 15 min at room temperature ...
-
bioRxiv - Bioengineering 2020Quote: ... Nuclei in the actin-stained samples were labeled with propidium iodide (7 µM, Molecular Probes, P3566). The stained samples were kept in PBS and visualized with a confocal laser scanning microscope (Leica TCS SP5X with a 40× /1.1 HCX PL Apo CS lens) ...
-
bioRxiv - Biophysics 2020Quote: ... hiPSCs were dissociated by incubating at 37°C for 7 minutes with TrypLE™ Express (ThermoFisher) and seeded at 125000 cells/cm2 on a Matrigel® coated 12 well plate ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cooled on ice before addition of 7 mL of pre-chilled phenol/chloroform (Ambion) to precipitate proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... The viability dyes DAPI and 7-AAD were used where appropriate (BD and Thermo Fisher Scientific). CellTrace Far Red (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... RT-qPCRs were run in a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). Relative quantification was determined using the ΔΔCt method and normalized to the endogenous controls RPLP0 and GAPDH (GAPDH FWD 5’-3’= GTTCGACAGTCAGCCGCATC ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Plant Biology 2020Quote: ... using QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems, Thermo Fisher Scientific, MA, USA). The primer pairs used are listed in Table S3 ...
-
bioRxiv - Bioengineering 2020Quote: ... and plates were read using a QuantstudioTM 7 Flex Real-Time PCR System (Thermo Fisher Scientific). Data was analyzed using the delta-delta CT method to generate box plots for a fold change of gene expression (with a fold change of 1 representing the gene expression of 100,000 hMSCs before seeding on scaffolds and composites) ...
-
bioRxiv - Microbiology 2020Quote: ... samples were desalted using HyperSep Filter Plates with a 5-7 µL bed volume (ThermoFisher Scientific) following the manufacturer’s instructions ...