Labshake search
Citations for Thermo Fisher :
1301 - 1350 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... about 5 million K562 cells were transfected with 5 μg luciferase reporter plasmid using Neon™ NxT Electroporation System (Invitrogen). Cells were fixed after 24 hours and ChIP performed as described above ...
-
bioRxiv - Molecular Biology 2024Quote: ... Samples were loaded onto the trap column (C18 PepMap100, 5 μm particle size, 300 μm x 5 mm, Thermo Scientific) for 4 min at 18 μL/min ...
-
bioRxiv - Microbiology 2024Quote: ... GP2-293 cells were seeded at 5×106 on 10-cm plates and transfected 24 h later with 5 µg of LUJV-flag/LUJV-flag-mut and 5 µg Luciferase using Lipofectamine 2000 (Invitrogen). Cells’ media were replaced 5 h later to full medium ...
-
bioRxiv - Genetics 2023Quote: RNA was extracted from the stock of D388-WT and the sequence of the 5′ UTR was determined using a 5′ RACE system for rapid amplification of cDNA ends (Invitrogen) using IBV-specific oligonucleotides 5′-TGTCTGCTCACTAAAC-3′ for the reverse transcription step and 5′-AGAACGTAGCCCAACGC-3′ for the amplification of dC-tailed cDNA step ...
-
bioRxiv - Cell Biology 2023Quote: Whole proteome and phosphopeptide samples were dissolved in 2% [v/v] ACN 0.1% [v/v] TFA and injected onto a C18 PepMap100-trapping column (0.3 x 5 mm, 5 μm, Thermo Scientific) connected to an in-house packed C18 analytical column (75 μm x 300 mm ...
-
bioRxiv - Microbiology 2023Quote: ... and primers (46) (5′-CAGAGATCGATCTGTTTCCTTGACACGCGTGCCACCATGTTCGTGTTCCTG-3′ and 5′-AATCTGTGTGCAGGGCGGCCGCTCAGGTGTAGTGCAGCTTCACG-3′) and cloned by using the Zero Blunt TOPO PCR Cloning Kit (ThermoFisher).
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Developmental Biology 2022Quote: ... at 38.5°C overnight in sealed sterile vials containing 5% CO2 in air-equilibrated Medium 199 with Earle’s salts (Thermo Fisher), supplemented with 10% fetal bovine serum (Hyclone) ...
-
bioRxiv - Plant Biology 2022Quote: ... chpre-MIR166A was amplified from genomic DNA of Cardamine Oxford ecotype using specific primers: FW 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGGAGGAAGGAAGGGGCTTTCT-3’ REV 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGCCCTAATTAAATTGAGAAGAAGG-3’ and cloned in pDONR221 Gateway vector by BP recombination (Invitrogen). pDONRP4_P1-ChSCRp (Di Ruocco et al ...
-
bioRxiv - Molecular Biology 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 10 μl/min ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Biochemistry 2022Quote: ... Samples (5 μl) were injected on a C18 PepMap trap column (5 μm, 100 μm I.D. x 2 cm, Thermo Scientific) at 20 μl/min ...
-
bioRxiv - Neuroscience 2023Quote: ... The blood was quickly collected with a syringe and transferred in 0.75 mL tubes containing 5 μL EDTA and 5 μL Halt protease and phosphatase inhibitor cocktail (100x, Thermo Scientific). Blood samples were centrifuged for 10 min at 2000 x g at 4°C ...
-
bioRxiv - Cell Biology 2023Quote: ... MiniBAR-GFP sta-ble cell line was transfected with 25 nM of siRNAs targeting luciferase (5’-CGUACGCGGAAUACUUCGA-3’) or human Rab35 (5’-GCUCACGAAGAACAGUAAA-3’) using Lipo-fectamine RNAiMAX (Invitrogen), following the manufac-turer’s instructions ...
-
bioRxiv - Synthetic Biology 2023Quote: ... to a final concentration of 5% and fetal bovine serum to a final concentration of 5% and 1% penicillin-streptomycin (Invitrogen) or Clear X9-Stem™ at 5% CO2 ...
-
bioRxiv - Microbiology 2023Quote: ... A549 cells were seeded in 96-well microtiter plates at a concentration of 5−104 cells per well for 24 h (37°C, 5% CO2) in DMEM (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... The infected cells were resuspended in HL5c containing 5 U mL−1 of penicillin and 5 μg mL−1 of streptomycin (Invitrogen) to prevent extracellular bacterial growth ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1.5 µg of total RNA of each sex were subjected to 5’ and 3’ RACE with a GeneRacer kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... and incubated for 2-24hrs at 37°C 5% CO2 +/- myristoylated aPKC pseudosubstrate inhibitor (5 μM; Invitrogen; Product number 77749) in IMDM+0.1% BSA ...
-
bioRxiv - Cancer Biology 2023Quote: ... and then washed twice with HBSS before incubating with staining solution (5 U/mL phalloidin AF568 [Invitrogen], 100 μg/mL concanavalin A AF488 [Invitrogen], 5 μg/mL Hoechst 33342 [ThermoFisher or Invitrogen] ...
-
bioRxiv - Microbiology 2023Quote: ... PCR covering the virus S2M region was performed on cDNA samples for 40 cycles with primers HJ551-S2UTRF: 5’-CTCCAAACAATTGCAACAATC-3’ and HJ552-S2UTRR: 5’-GTCATTCTCCTAAGAAGCTATTAAAATC-3’ using the High Fidelity AccuPrime Taq DNA Polymerase (Invitrogen) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... An Acclaim PepMap C18 trap-column (5 µm particle size, 0.3 mm ID x 5 mm length; ThermoFisher Scientific, #160454) was used to concentrate the sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were seeded in 6-well plates (2.25 x 10^5 cells per well) supplemented with 5 nM siRNA premixed with Opti-MEM Reduced Serum Medium (Gibco) and Lipofectamine RNAi Max Transfection Reagent (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2023Quote: ... Peptides were trapped on a PepMap C18 trap column (300 µm x 5 mm, 5 µm particle size, Thermo Fisher) and separated on a 50 cm Easy-Spray column (ES803 ...
-
bioRxiv - Microbiology 2023Quote: ... or the same concentration of scrambled siRNA (sense, 5’- UUCUCCGAACGUGUCACGUTT -3’; antisense, 5’- ACGUGACACGUUCGGAGAATT -3’) purchased from Tsingke Biotechnology (Beijing, China) with Lipofectamine 3000 (Invitrogen) according to the manufacturer’s recommendations.
-
bioRxiv - Immunology 2023Quote: ... SFB736F (5′-GACGCTGAGGCATGAGAGCAT-3′)/SFB844R (5′-GACGGCACGGATTGTTATTCA-3′) were used in a 7500 Fast Real-Time PCR System (Life Technologies) to quantify SFB level in the feces ...
-
bioRxiv - Bioengineering 2023Quote: ... the gels were washed with wash buffer three times for 5 min followed by permeabilization and blocking in 5% goat serum (Gibco), 1% BSA ...
-
bioRxiv - Molecular Biology 2023Quote: ... primers with upstream attB-regions suitable for BP-clonase-recombination (attB1: 5′-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAACA-3′; attB2: 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′, Gateway Technology, Invitrogen). By same the method ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples (5 μL) were injected on a C18 PepMap trap column (5 µm, 300 µm I.D. x 2 cm, Thermo Scientific) at 20 µL/min ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5 µl were mixed with 5 µl of Power SYBR™ Green PCR Master Mix (Applied Biosystems Cat. # 4367659) containing 200 nM each of forward and reverse primer for AXIN2 (Fwd ...
-
bioRxiv - Biochemistry 2024Quote: Enriched crosslinked peptides were injected onto a C18 PepMap100-trapping column (0.3 x 5 mm, 5 μm, Thermo Scientific™) connected to an in-house packed C18 analytical column (75 μm x 300 mm ...
-
bioRxiv - Biochemistry 2024Quote: The tryptic peptides were injected onto a pre-column (PepMap C18, 5 mm × 300 μm × 5 μm, Thermo Fisher Scientific) and separated ...
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Microbiology 2024Quote: ... the cell suspension of infected amoebae was detached from the culture dish and resuspended in HL5-C with 5 U/mL penicillin and 5 μg/mL of streptomycin (Gibco) to inhibit extracellular growth of bacteria ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl of 5 mg/ml glycogen (Ambion), and 1 ml of cold isopropanol ...
-
bioRxiv - Biophysics 2021Quote: ... wash with 5 mL DPBS (Thermofisher, cat. # 14190144) and aspirate ...
-
bioRxiv - Cancer Biology 2021Quote: ... EdU 10μM (5-ethynyl-2’-deoxyuridine, ThermoFisher Scientific) diluted in fresh medium was added in the well for 10 minutes (MIA PaCa-2) ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 5% fetal calf serum (Gibco #16030074) and 200 nM 12-Otetradecanoyl phorbol-13-acetate (Sigma #16561-29-8) ...
-
bioRxiv - Molecular Biology 2020Quote: ... and blocking with 5× Denhardt’s solution (Thermo Scientific) for 1 h at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... was supplemented with 5% Horse Serum (Life Technologies), 10ug/ml Insuline ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 µl of fluorescent microbeads (FluoSpheres; Molecular Probes) were incubated with 0.1 mg/ml PLL-PEG on a rotator for 1 h at 4°C prior to mixing with the gel mixture ...
-
bioRxiv - Genetics 2021Quote: ... and 5% heat-inactivated FBS (Thermo Fisher Scientific). All cells were cultured at 25°C and were free from mycoplasma contamination.
-
bioRxiv - Genomics 2021Quote: ... containing 10% FBS and 5% pen/strep (ThermoFisher). Cells were counted with a hemocytometer and Seq-Well S3 was performed as described below43 ...
-
bioRxiv - Cell Biology 2020Quote: ... Molecular Probes)/PBS solution or 5 mg/ml Hoescht (Invitrogen)/PBS solution was carried out for 15 min at RT ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 5 μM MitoSOX Red (MR; Thermofisher; detects superoxide), or 0.1 mM dihydrorhodamine 123 (DHR ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... loaded with 5 μM Rhod-2,am (ThermoFisher) in a zinc-containing HEPES-based salt solution (HBSS ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 5 μL of 10X T4 Ligase Buffer (ThermoFisher), 2.5 μL of T4 Ligase (ThermoFisher) ...
-
bioRxiv - Biochemistry 2022Quote: ... + 5 μg/mL Blasticidin (ThermoFisher, catalog number A1113903). For treatment experiments ...
-
bioRxiv - Cell Biology 2022Quote: ... supplemented with 5% fetal calf serum (FCS; Gibco), 5% human serum AB (Sigma) ...
-
bioRxiv - Biochemistry 2022Quote: 5 mg of Amplex Red (AR; Invitrogen A12222) was dissolved in 0.9725 mL neet DMSO to yield a 20 mM solution ...