Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for 5 Nitrofluorescein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Puromycin at 5 µg/ml (Thermo Fisher), VPS34 IN1 at 2 µM for 3h (APE-B6179 ...
-
bioRxiv - Microbiology 2024Quote: ... 5′ phosphorylation (T4 PNK, Thermo Fisher Scientific), self-ligation (T4 DNA ligase ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 µL of Proteinase K (ThermoFisher Scientific) was added to the sample and incubated for 2 h at 55°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and DAPI (Invitrogen, D1306, 5 µg/ml). The sections were mounted with Vectashield (Vector Laboratories).
-
bioRxiv - Neuroscience 2024Quote: ... 5% CO2 in low-glucose DMEM (Gibco) with 10% foetal bovine serum with one-time media change after 8 hours ...
-
bioRxiv - Biophysics 2024Quote: ... and 5 μM calcein AM (C3099, Invitrogen) and then placed in the incubator at 37°C and 5% CO2 for at least one hour ...
-
bioRxiv - Molecular Biology 2024Quote: ... 5 µg of anti-SRSF3 (#334200, Invitrogen) or anti-IgG (#Sc-2025 ...
-
bioRxiv - Genetics 2024Quote: ... containing Draq-5 DNA dye (Life technologies) at a 1/5000 dilution.
-
bioRxiv - Biophysics 2024Quote: ... supplemented with 5% FBS (Gibco, Carlsbad, CA) and 1% Pen/Strep (Gibco ...
-
bioRxiv - Biophysics 2024Quote: ... containing 5% fetal bovine serum (FBS) (Gibco) and 1% antibiotic-antimycotic (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... supplemented with 5% fetal horse serum (Gibco), 10 µg/ml insulin ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 U/ml Penicillin-Streptomycin (Gibco), and passaged two times a week using 0.5 mM EDTA (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 µg/ml trypsin (Thermo Fisher) were added to the eluate for on-bead digestion for 1 hour shaking at 25 °C ...
-
bioRxiv - Bioengineering 2024Quote: ... supplemented with 5% (v/v) FBS (Gibco) and 1% antibiotic/antimycotic (100 U/mL penicillin and 100 mg/mL streptomycin ...
-
bioRxiv - Microbiology 2024Quote: ... peptone 5 g/L (Thermo Fisher Scientific). P ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5 % foetal calf serum (Fisher Scientific; 26140079), 1 % P/S and 5 µg/ml Apo-Transferrin (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5% donkey serum (Thermo Fisher Scientific, #31874), and 0.3% Triton-X (Fisher Scientific ...
-
bioRxiv - Biochemistry 2024Quote: ... 5 mL N2 growth supplement 100X (Gibco); 1 mM Heparin Sulfate (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... Claudin-5 (1:200, Invitrogen, 34-1600), and Zo-1 (1:200 ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5% non-essential amino acids (Gibco). Cells were maintained at 37 °C in a 5% CO2 environment with saturated humidity.
-
bioRxiv - Cell Biology 2024Quote: ... 5 μl Lipofectamine 2000 (Thermo Fisher Scientific) was used with the following DNA quantities per well of a 6-well plate ...
-
bioRxiv - Systems Biology 2024Quote: ... 5 µL 5X First Strand buffer (Invitrogen) was added ...
-
bioRxiv - Immunology 2024Quote: ... CellTrace Violet (CTV) (Invitrogen, C34557 5 µM); Cell Stimulation Cocktail (500X ...
-
bioRxiv - Immunology 2024Quote: ... with EDTA 5 mM (Invitrogen 15575-038), FBS (Eurobio ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM EDTA (Thermo Fisher Scientific). Lysate was clarified by centrifugation and total protein concentration was measured with the BCA Protein Assay (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5% v/v B27 supplement (Gibco), then the media were replaced with Neurobasal media supplemented with 1% FBS ...
-
bioRxiv - Neuroscience 2024Quote: ... and 5 mg/mL human insulin (ThermoFisher) freshly supplemented with 100 ng/mL IL-34 ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL GlutaMAX (1X, Gibco Cat#35050061), 5 mL penicillin-streptomycin (Gibco Cat# 15070063) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL penicillin-streptomycin (Gibco Cat# 15070063), 7.5 mL HEPES buffer (15 mM ...
-
bioRxiv - Neuroscience 2024Quote: ... supplemented with 5% FBS (Gibco, #A52567-01), 1% D-(+)-Glucose (Sigma ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 5 mM EDTA (Thermo Fisher Scientific). Lysate was clarified by centrifugation and total protein concentration was measured with the BCA Protein Assay (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2024Quote: ... 5 mL of Neon Buffer R (Invitrogen), and 1 mL of reconstituted sgRNA to promote Cas9-ribonucleoprotein (RNP ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... desalted on a C8 column (Acclaim PepMap, 300 μm x 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific), and separated on a C18 column (Acclaim PepMap ...
-
bioRxiv - Cancer Biology 2022Quote: ... Minced tissues were incubated in digestion medium (Collagenase type II 5 mg/ml [GIBCO], Dispase 5 mg/ml [GIBCO] ...
-
bioRxiv - Microbiology 2022Quote: ... at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (Gibco), 5% Cosmic calf serum (Hyclone) ...
-
bioRxiv - Cell Biology 2022Quote: ... at 37°C for 10 minutes and blocked with DPBS containing 5% BSA and 5% normal goat serum (Gibco), for 30 mins at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and 5 pmol was 5’-end labeled with 20 μCi of Ψ-P32 ATP using Polynucleotide Kinase (Thermo Fisher) and subsequently purified using an Illustra MicroSpin G-50 column (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2019Quote: ... Amplification of cyp51A was performed using the L98HR primer (5’-TTCGGTGAATCGCGCAGATAGTCC-3’) and TR34R primer (5’-AGCAAGGGAGAAGGAAAGAAGCACT-3’) (Invitrogen) at 100 nM ...
-
bioRxiv - Biochemistry 2020Quote: ... UK) with an Acclaim PepMap C18 trap column (0.3 mm × 5 mm, 5 μm, 100 Å, Thermo Fisher Scientific). The mobile phases were A ...
-
bioRxiv - Bioengineering 2019Quote: ... The montaged image in Figure 5 C ii and 5 C iii were generated by stitching together individual images using MAPS 1.1 software (ThermoFisher).
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2022Quote: ... 5 μg total RNA were denatured for 5 mins at 95°C in RNA Gel loading dye (Thermo Scientific) before being separated on 1% agarose gels in 1X TBE (native ...
-
bioRxiv - Cancer Biology 2023Quote: ... and LCPNS-SIIN-Cxcl1KO cells were cultured at 37°C under 5% CO2 / 5% O2 in Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12 medium, Gibco) supplemented with 1% N2 (Gibco) ...