Labshake search
Citations for Thermo Fisher :
1251 - 1300 of 1901 citations for PVRIG Cynomolgus HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... which were pre-loaded with 10 μL of Hi-Di™ formamide (ThermoFisher, Waltham, USA) and GeneScan™ -400HD ROX™ Size standard (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... This PCR fragment was TOPO cloned into pcDNA™3.1/V5-His backbone (Invitrogen, V81020). We used in vivo assembly cloning 40,41 for site directed mutagenesis to modify the nucleotide 1 bp upstream of the exon 49 splice junction to each of the alternative nucleotides (Supplementary table 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... The His-tagged dAsapPZA protein was expressed and purified following the manufacturer’s guidelines (Invitrogen, USA).
-
bioRxiv - Immunology 2023Quote: ... Glycan samples were run with a LIZ 600 DNA ladder in Hi-Di formamide (ThermoFisher) on an ABI 3500xL DNA sequencer and analyzed with GlycanAssure Data Acquisition Software v.1.0 ...
-
bioRxiv - Biophysics 2023Quote: ... His-tag purification was performed in Pierce disposable polypropylene 5mL disposable columns (Thermo Fisher Scientific) with a wash solution containing TNi 100/300/20 (100 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding region for Hsc70-4 (CG4264) was cloned into pAc5.1/V5-His A (Invitrogen), and into pcDNA™6/myc-His A (Invitrogen) ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... with the Ion PI™ Hi-Q™ Chef Kit (Thermo Fisher Scientific, Catalog # A27198) and Ion PI™ Chip Kit v3 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... or F-vec were cultured in DMEM + 10% HI FBS with Zeocin (Thermo Fisher Scientific) selection ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved in heat-inactivated fetal-bovine serum (HI-FBS, ThermoFisher Gibco™ #12484028, USA) + 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved in heat-inactivated fetal-bovine serum (HI-FBS, ThermoFisher Gibco™ #12484028, USA) + 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... The pIgR gene was inserted into the pEF-Myc-His vector (ThermoFisher Scientific, MS, USA).
-
bioRxiv - Neuroscience 2023Quote: ... rattus Piccolo (2622-2937) DNA was cloned into vector pCDNA3.1-myc-his(C) vector (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... One microliter of sample was diluted in 9 ul Hi-Di™ Formamide (Applied Biosystems) containing 0.25 ul GeneScan™ 600 LIZ™ Size Standard ...
-
bioRxiv - Immunology 2024Quote: ... Amplified PCR fragments were inserted into the metallothionein promoter driven pMT-V5-His vector (Invitrogen). The generated vector was co-transfected with a pCoBlast blasticidin resistance vector with a ratio of 19:1 and cells were selected in blasticidin containing medium according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... in HepG2 medium (Advanced MEM minus L-Glutamine [Gibco] + 10% [v/v] HI-FBS [Gibco] + 1% [v/v] penicillin-streptomycin + 2 mM Glutamax [Gibco] and 0.1% [v/v] amphotericin B) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The PCR product was mixed with Hi-DiTM mix (Thermo Fisher Applied BiosystemsTM, Carlsbad, USA) with GeneScantm LIZ dye Size standardtm (Thermo Fisher Applied BiosystemsTM ...
-
bioRxiv - Immunology 2024Quote: ... Blot was then incubated with 1:1000 dilution anti-his conjugated to HRP (Thermo Scientific) in 5% milk in 1xTBST (1 h ...
-
bioRxiv - Microbiology 2024Quote: ... and the other was treated with 20 U of recombinant Escherichia coli RNase HI (Invitrogen) overnight at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... and passed through a 3 mL His-Pur Ni-NTA column (Thermo Scientific, catalog # 88226) according to manufacturer instruction ...
-
bioRxiv - Biophysics 2020Quote: HeLa and HEK293 cells were cultured at 37°C in an atmosphere of 5% CO2 in air in DMEM (Gibco, #10566024) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Biophysics 2022Quote: ... The resulting HEK293 based stable cells were grown and maintained in adherent cell culture in Dulbecco’s Modified Eagle Medium (DMEM, Thermo Fisher Scientific) supplemented with 9% Fetal Bovine Serum (FBS ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng of the library were transfected into 250 000 HEK293 cells in one well of a 6-well plate using Lipofectamine 2000 (11668027, ThermoFisher Scientific) and OPTIMEM I Reduced Serum Medium (31985-047 ...
-
bioRxiv - Biophysics 2019Quote: HEK293 cells were grown in 1:1 Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 Ham with Glutamax+ (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (Alkali Scientific ...
-
bioRxiv - Biophysics 2019Quote: Human embryonic kidney cells 293 (HEK293-6E, NRC, Canada) were cultured in FreeStyle F17 expression medium (Thermo Fisher Scientific, Waltham, MA) supplemented with 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cell Biology 2021Quote: ... N-terminal FLAG-tagged human MCC (P23508-1) constructs (pCMV2B vector) were transfected into HEK293 cells and selected with G418 (Gibco #10131035). G418-resistant cells were grown ...
-
Micro RNAs are minor constituents of extracellular vesicles and are hardly delivered to target cellsbioRxiv - Cell Biology 2020Quote: ... the EBV-positive Burkitt lymphoma cell line Raji and the HEK293-based EBV producer cell lines were maintained in RPMI medium 1640 (Life Technologies). HEK293T cells were maintained in DMEM (Life Technologies) ...
-
bioRxiv - Biophysics 2021Quote: Human wild type ABCG2 or ABCG2 R184A containing an N-terminal Flag-tag was expressed in HEK293-EBNA (Thermo Fisher Scientific) cells as previously described19 ...
-
bioRxiv - Neuroscience 2022Quote: LC-MS/MS analyses were conducted using either a QExactive Plus Orbitrap (QE, RNase-digested polysomes) or a Velos Pro Elite Orbitrap (Elite, virus polysomes and HEK293 aggregates) mass spectrometer (Thermo Fisher) coupled online to a nanoAcquity UPLC system (Waters Corporation ...
-
bioRxiv - Neuroscience 2020Quote: MARK4 expressed in HEK293 cells was immunoprecipitated from the cell lysate with monoclonal anti-Myc antibody (4A6) and Dynabeads protein G (Thermo Fisher). Its kinase activity was measured using human 2N4R tau ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, USA), penicillin ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: African green monkey kidney epithelial cells (Vero, ATCC) and HEK293 T cells (ATCC) were cultured in DMEM containing 10% fetal bovine serum (FBS, Gibco Invitrogen) at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: All transfection experiments were performed in HEK293 FT and cell lines using an optimized Lipofectamine 3000 transfection protocol (Life Technologies, L3000015). For RNA silencing in 293 HEK ...
-
bioRxiv - Microbiology 2020Quote: HEK293 FT (ATCC CRL-3216) and VERO (ATCC CCL-81) cell lines were cultured in DMEM high glucose media (Life Technologies) containing 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: All E2 cores (E2c3, E2mc3, and E2mc3 v1-v10) and E2p-based nanoparticles were transiently expressed in HEK293 F cells (Thermo Fisher) for biochemical ...
-
bioRxiv - Immunology 2021Quote: ... IgGs and 6xHis-tagged Fabs were expressed by transient transfection of paired heavy chain and light chain expression plasmids into HEK293-6E or Expi293 cells (Life Technologies). Fabs and IgGs were purified from transfected cell supernatants using Ni-NTA (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... a heavy chain (HC) and light chain (LC) plasmid was generated for co-expression in HEK293 suspension culture cells (Expi293F cells) (Fisher Scientific). For species specificity swapping experiments ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... 293 cells from a pMLINK tetracistronic vector (courtesy of Y. Shi, Tsinghua University, Beijing).45 HEK293 cells were cultured in Freestyle 293 media (Life Technologies), shaking at 125 rpm while incubating at 37 oC with 8% CO2 until a density 2 × 106 cells/ml was reached ...
-
bioRxiv - Immunology 2021Quote: HEK293 cells were transiently transfected with SARS-CoV-2-S fragments expression vectors using Lipofectamine 2000 Transfection reagent (Thermo Fisher Scientific). Two days later ...
-
bioRxiv - Molecular Biology 2021Quote: ... the coding sequence encoding human TSPO (hTSPO) was amplified from cDNA previously generated by reverse transcription from total HEK293 mRNA isolated using Trizol (Life Technologies) and cloned into either a pENTR/SD/TOPO vector (Invitrogen ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 S gene containing plasmid p20017 and adenovirus backbone plasmid pAADV-C01 (Genemedi, China) were co-transfected into HEK293 based adapted viral production cell (ThermoFisher, USA). Viral production cells were seeded in a 6 well TC treated plate (Nest ...
-
bioRxiv - Cancer Biology 2022Quote: ... LCV2-GFP or LCV2-RFP were mixed with sPAX2 and MD2.G plasmids and transfected in HEK293 cells using Lipofectamine 2000 (Life Technologies). After 24h ...
-
bioRxiv - Neuroscience 2022Quote: SARS-CoV-2 Spike proteins (recombinant SARS-CoV-2 Spike Protein (SP-RBD, Arg319-Phe 541; cat# RP-87678, HEK293 cell expressed and binds ACE2) was obtained from Life Technologies Corporation ...
-
bioRxiv - Biochemistry 2024Quote: ... A549 and the HEK293 cell line stably transduced with a firefly luciferase reporter under the control of a synthetic NF-κB promoter (HEK293-NF-κB_luc, BPS-Bioscience) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, Cat# 61965-026) supplemented with 10 % fetal calf serum at 37 °C in a 5 % CO2 incubator.
-
bioRxiv - Immunology 2024Quote: ... We electroporated 3 μg of ODNs or gDNA into 2 × 106 HEK293 and 293A cells by Neon Transfection System (Thermo Fisher) based on the manufacturer’s introductions.
-
bioRxiv - Developmental Biology 2024Quote: Cultured HEK293 cells were grown on 12 mm round cover glasses (Azer Scientific, #200121) pre-coated with poly-D-lysine (Gibco, #A3890401) in 24-well plates and then transfected with a plasmid encoding HA-tagged neurexin1 alpha using lipofectamine 2000 ...