Labshake search
Citations for Thermo Fisher :
1201 - 1250 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2024Quote: ... the full length of FLP1 cDNA was amplified by the primers (5’- CACCATGTCTGGTGTGTGGGTATTCAACA -3’ and 5’-TACTACATGTCACGGACATGGAAG-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). Once sequences of FLP1 cDNA were verified ...
-
bioRxiv - Plant Biology 2024Quote: ... The NTF sequences were amplified using primers (5’-CACCATGGATCATTCAGCGAAAACCACACAG-3’ and 5’-TCAAGATCCACCAGTATCCTCATGC-3’) and cloned into the pENTR/D-TOPO vector (Invitrogen). The CAB2 promoter region (324 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... or siMIIP (s34150, sequence sense 5’- AGGAGUUUCGGGAAACCAAtt-3’), or siPOC5 (AD39Q91, sequence sense 5’- CAACAAAUUCUAGUCAUACUU-3’) using Lipofectamine RNAi MAX reagents (Invitrogen). Medium was changed 5-6 hours post-transfection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sch was removed and 500 μL 4% paraformaldehyde (PFA) stabilized with phosphate buffer (Thermofisher Scientific) was added for 10-15 minutes on a rotary machine (PTR-35 360 vertical multi-function rotator ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cells were seeded in 6-well plates (5×105/well) were transfected with the indicated siRNA (3 μg) using Lipofectamine® 2000 transfection reagent (Life Technologies, 11668-019) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 6 gram of 5% G-250 NativePAGE Sample additive (Invitrogen) was added per gram of mitochondria-enriched fraction ...
-
bioRxiv - Biophysics 2021Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Cell Biology 2020Quote: ... A pool of 4 siRNAs targeting mouse SNAP-47 and control Luciferase siRNA (Target Sequence: 5’-CGTACGCGGAATACTTCGA-3’) (Dharmacon, Thermofisher Scientific) were electroporated along with GFP into E15.5 cortical neurons (2 µg GFP + 50 pmol siRNAs) ...
-
bioRxiv - Cell Biology 2023Quote: ... maintained at 37° C and 5% CO2 and passaged every 3-4 days using trypsin-EDTA 0.05% (Life Technologies, Paisley, UK) to detach the cells ...
-
bioRxiv - Physiology 2024Quote: ... plus 1% penicillin/streptomycin in a humidified incubator at 37 °C and 5% CO2 and passaged every 3-4 days using 0.05% of Trypsin-EDTA (Thermo Fisher Scientific) to lift the cells from the culture dish ...
-
bioRxiv - Immunology 2022Quote: ... 700 μg of protein were mixed and rotated with 0.5 μg of STING antibody for 3 h at 4 °C after which 25 μL of Dynabeads Protein G (Invitrogen, 10004D) were added to each sample and rotated for an additional hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... or T50E proteins were diluted to 3 µg/ml in Dulbecco’s phosphate-buffered saline (PBS; Gibco) containing 0.1% BSA and 0.02% Tween-20 and immobilized on NTA capture sensors (FortéBio) ...
-
bioRxiv - Molecular Biology 2021Quote: The NP tissues were washed 3 times with phosphate-buffered saline (PBS; Gibco, Grand Island, NY), minced into small fragments and digested in 0.25% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... cells were washed 3 x 30 minutes with 100µl of phosphate buffered saline (PBS; #P5119; Gibco) at 37°C to remove excessive mucus ...
-
bioRxiv - Neuroscience 2023Quote: ... Complement C1q A Chain (C1qa) and glyceraldehyde-3-phosphate dehydrogenase (Gapdh) as endogenous control (Life Technologies). Each sample was run in triplicate in 20 μl of reaction volume using TaqMan Universal PCR Master Mix according to the manufacturer’s instructions (Life Technologies ...
-
bioRxiv - Microbiology 2023Quote: ... cRNA and vRNA or cellular glyceraldehyde 3-phosphate dehydrogenase (GADPH) with SuperScriptTM III Reverse Transcriptase (Invitrogen), and quantified using SYBR-Green (Roche ...
-
bioRxiv - Genomics 2020Quote: ... 4 × 10−5 % biotin (Life Technologies #B1595), 13.4 g/ l (1.34% (w/v) ...
-
bioRxiv - Immunology 2021Quote: ... 5/6 weeks and 6/7 weeks post-infection by flow cytometry using counting beads (CountBright, ThermoFisher).
-
bioRxiv - Cancer Biology 2023Quote: ... ANBL-6 cells were also supplemented with 5 ng/ml IL-6 (Thermo Fisher Scientific, Cat# 206IL010).
-
bioRxiv - Bioengineering 2023Quote: ... Interleukin-2 (IL-2; Clinigen, US-CA) was diluted in phosphate buffered saline (PBS; Thermo Fisher Scientific, US-CA) and added at a final concentration of 300 I.U./mL ...
-
bioRxiv - Neuroscience 2022Quote: ... forward−5’ AAAACTAGTGAACCGTCAGATCCGCTAG-3’;PspXI (Thermo Fisher Scientific), reverse ...
-
bioRxiv - Microbiology 2021Quote: ... R2 5’-gtgccctttctccatttggt-3’ using superscript III (Invitrogen) and SYBR green (Applied Biosystems ...
-
bioRxiv - Genomics 2021Quote: ... and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen, UK) primer sequences comprised part of the Illumina adaptor sequence (underlined) ...
-
bioRxiv - Genomics 2021Quote: ... Reverse UpTag primer 5’ – CACGACGCTCTTCCGATCTAGTANNNNGGGGACGAGGCAAGCTAAGATATC-3’ (Invitrogen, UK) and reverse DnTag 5’ – CACGACGCTCTTCCGATCTAGTANNNNCGCCATCCAGTGTCGAAAAGTATC-3’ (Invitrogen ...
-
bioRxiv - Immunology 2022Quote: ... on a QuantStudio 3 or 5 instrument (ThermoFisher). A standard curve of viral RNA of known copy number was run in parallel.
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-UAGUGACUUCUGGAAAUUCag-3’ (antisense) (Ambion by Life Technologies); siRNA#4 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Cell Biology 2024Quote: ... 5’-CGACCAGUCUGUCUGUUGGtt-3’ (antisense) (Ambion by Life Technologies); siRNA#3 ...
-
bioRxiv - Immunology 2023Quote: ... then resuspended with 5 uM DiSBAC2(3) (Invitrogen), 2.5 uM DCFDA (AdipoGen Life Sciences ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2023Quote: ... 6 μL was injected onto an Acclaim PepMap 100 column packed with 2 cm of 5 μm C18 material (Thermo Fisher, 164564) using 0.1% formic acid in water (solvent A) ...
-
bioRxiv - Cancer Biology 2023Quote: LN-229 cells were seeded at 2×10^5 cells/well into in 6-well Nunc™ Cell-Culture Treated Multidishes (ThermoFisher, #140675) and incubated overnight in reduced serum media at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: 0.5 × 106 cells from HL-60 were harvested by centrifugation and resuspended in PBS 200 μL with 10 μM 5-(and-6)-chloromethyl-2′,7′—containing Acetyl ester of dichlorodihydrofluorescein diacetate (H2 -DCF, Eugene, Molecular Probes, OR) and 0.4 μg/mL 12-O-tetradecanoylphorbol-13-acetate (TPA ...
-
bioRxiv - Immunology 2022Quote: ... Cells then were washed twice with FACS buffer and stained for 5 minutes at 4°C with 0.5 mg/mL of 40,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher). PE and DAPI staining were measured with an iQue Screener Plus flow cytometer (Intellicyt ...
-
bioRxiv - Biochemistry 2020Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotech ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 4-6 days with Versene solution (Gibco). A control iPS cell line (MIN09i-33114.C ...
-
bioRxiv - Physiology 2020Quote: ... and sectioned (4-6 micron) using a Microm HM 325 (ThermoFisher). Tissue sections were then stained with Weigert’s iron hematoxylin and Masson Trichrome (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg plasmid and 6 µl Turbofect (Thermo Fisher Scientific, USA) were combined ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were labeled with DAPI (4’,6-diamidino-phenylindole, Invitrogen) and subsequently mounted onto a glass slide and cover-slipped using an antifade mounting medium.
-
bioRxiv - Cell Biology 2024Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotec ...
-
bioRxiv - Physiology 2024Quote: ... and sectioned (4-6 micron) using a Microm HM 325 (ThermoFisher). Trichrome staining was performed as previously described.[37] Heart sections were de-paraffinized and stained with Weigert’s iron hematoxylin and Masson Trichrome (Sigma-Aldrich ...
-
bioRxiv - Pathology 2022Quote: ... 5 mg of 5-ethynyl-2′-deoxyuridine (EdU, A10044, Invitrogen) was dissolved in 1 ml of PBS as a stock solution ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Biophysics 2021Quote: ... slides were rinsed in PBS for 3 x 5 mins and stained with 1 %g/mL 4,6-diamino-2-phenylindole (DAPI - Molecular Probes) for 3 mins in the dark at RT ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Duplex of the MEF2C enhancer sequence containing a mutation site [5′-ATGTATTTTTCTGCAATAAGT-3′ (×2)] in human genomic DNA were synthesized (Invitrogen). Additionally ...
-
bioRxiv - Microbiology 2020Quote: ... 2 eggs were inoculated with Dulbecco’s Phosphate Buffered Saline (DPBS, Gibco, Life Technologies Limited) and ...