Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 10000+ citations for 2 3 5 6 Tetrahydroxy 4 phosphonooxycyclohexyl dihydrogen phosphate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... were loaded at 3 μl/min for 6 min onto a 2 cm × 75 μm C18 trap column (Acclaim Pepmap 100, 3 μm, 300 Å, Thermo Scientific) in loading buffer (0.5% v/v formic acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotinylation of Htz1(V126C) was carried out using N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)propionamide (HPDP-Biotin) (Thermo Fisher cat. # 21341), which has a pyridyl disulfide moiety ...
-
bioRxiv - Molecular Biology 2024Quote: ... mCherry-LacI-FokI-WT and mCherry-LacI-FokI-D450A expressing vectors 24 were transfected in U2OS 2-6-3 cells using Lipofectamine LTX (Invitrogen; #15338-100) for 24 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... #3: 5′-GAAUAUUGAACUGGAAGCAGCACAU-3′) were purchased as Stealth RNAi siRNAs from Invitrogen. The target sequences were designed using the Block-iT RNAi Designer tool (Invitrogen ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Bioengineering 2021Quote: ... and resuspended in 4 °C 1x phosphate-buffered saline (PBS, Thermo Fisher Scientific 10010023) to generate cell suspensions used for scWB and scIEF.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Heads were fixed in phosphate-buffered solution (PBS) with 4% paraformaldehyde (Thermo Fisher Scientific) containing 0.008% Triton X-100 (Sigma-Aldrich ...
-
bioRxiv - Physiology 2020Quote: The kidney was fixed in 4% formaldehyde in phosphate buffered saline (Invitrogen, Carlsbad, CA), embedded in paraffin blocks ...
-
bioRxiv - Cancer Biology 2023Quote: ... PTP activity was assayed using 6,8-Difluoro-4-Methylumbelliferyl Phosphate (DiFMUP, Invitrogen, cat# D6567,) as a substrate in 3,3-Dimethylglutaric acid (DMG ...
-
bioRxiv - Neuroscience 2023Quote: ... differentiated midbrain neurons were fixed in 4% paraformaldehyde in phosphate buffered saline (Life Technologies) for 20 min followed and permeabilized / blocked in PBS with 0.3% Triton X-100 containing 2% bovine serum albumin and 3% normal goat serum for 30 min ...
-
bioRxiv - Neuroscience 2024Quote: ... and a solution of phosphate buffered saline (PBS) followed by 4% formaldehyde (Thermofisher 28908) in 0.1M PB pH 7.4 was perfused through the left ventricle ...
-
bioRxiv - Microbiology 2023Quote: ... Relative expression of Mx1 to housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH, Thermo Fisher, Mm99999915_g1) was calculated by ΔΔCT method38 ...
-
bioRxiv - Microbiology 2023Quote: ... washed 3 times with sterile 1X phosphate buffered saline (PBS, Thermo Fisher Scientific, Emeryville, CA), and frozen in glycerol at-80°C ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-GAPDH (anti-glyceraldehyde-3-phosphate dehydrogenase; catalog number MA5-15738; Invitrogen; dilution 1:5000), anti-TDP-43 (catalog number 10782-2-AP ...
-
bioRxiv - Biochemistry 2024Quote: ... and Assay Buffer 3: Dulbeccòs phosphate buffer saline (D-PBS) pH 7.4 (Gibco 14040-133). In parallel ...
-
bioRxiv - Physiology 2024Quote: ... followed by 3 washes (15 min each) in phosphate buffered saline (PBS, pH 7.4; ThermoFisher; containing antibiotic-antimycotic (1x ...
-
bioRxiv - Biochemistry 2021Quote: ... 6,8-Difluoro-4-Methylumbelliferyl Phosphate (DiFMUP, #D22065) and 6,8-difluoro-7-hydroxy-4-methylcoumarin (DiFMU, #D6566) were purchased from Life Technologies.
-
bioRxiv - Neuroscience 2023Quote: Cells were fixed with 4% paraformaldehyde and stored at 4°C until blocked with 10% donkey serum in Phosphate-Buffered Saline (PBS) (Invitrogen) and 0.25% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Physiology 2022Quote: ... then perfused the lungs with 3 mL of ice-cold DPBS containing Ca2+ and Mg2+ followed by 5 mL of 4% methanol-free formaldehyde (ThermoFisher) in DPBS containing Ca2+ and Mg2+ ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% CO2 in a humidified incubator and were passaged every 3-4 days using 0.05% Trypsin-EDTA (ThermoFisher Scientific, 25300). Stable U2OS-derived cell lines ...
-
bioRxiv - Immunology 2020Quote: ... 2-mercaptoethanol (5 µM, Gibco) and 150 IU/ml human rIL-2 and 50ng/ml rIL-15) ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Immunology 2020Quote: ... before staining with 3 μM fluo-4 (Invitrogen) and 4 μM Fura Red (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2024Quote: ... 4 × 10−3 M GlutaMAX supplement (35050061, Gibco), 2 × 10−4 M L-cystine (C7602 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Fgfrb_fwd 5’-AAACGCGAAAAGACCCTGATAGC-3’ and Fgfrb_rev 5’-GGACAGCGGGGACGTCAG-3’ Antisense probe was synthesized by in vitro transcription (MEGAScript Kit; Ambion) driven by T7 RNA polymerase with DIG incorporation (Roche) ...
-
bioRxiv - Molecular Biology 2021Quote: ... STAG3: 5’-CUGGAUUAACAUGCCUACU(dTdT)-3’ WAPL: 5’- GUCCUUGAAGAUAUACCAA(dTdT)-3’ Oligonucleotides were transfected using Lipofectamine RNAiMAX (Thermo Fisher; 13778150) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... N gene reverse primer (5’-GAGGAACGAGAAGAGGCTTG-3’) and probe (5’-FAM-ACTTCCTCAAGGAACAACATTGCCA-QSY-3’) using Taqman mastermix (Thermo Fisher). The thermal cycling steps were ...
-
bioRxiv - Immunology 2022Quote: ... The number of DCV copies in these samples was quantified using DCV specific primers (DCV_Forward: 5′ AATAAATCATAAGCCACTGTGATTGATACAACAGAC 3′, DCV_Reverse: 5′ AATAAATCATAAGAAGCACGATACTTCTTCCAAACC 3′) and Fast SYBR green (Applied Biosystems) based qRT-PCR (Applied Biosystems StepOne Plus) ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Microbiology 2020Quote: ... 10pmol of each the forward and the reverse primers: (HAV1; 5’ - GCTCCTCTTTATCATGCTATGGAT-3’ and rHAV2; 5’-CAGGAAATGTCTCAGGTACTTTC-3’) and 12.5μl of PCR Reddy master mix (Thermo Scientific). PCR products (6μl ...
-
bioRxiv - Cell Biology 2023Quote: ... and reference 18S ribosomal RNA gene (Forward primer: 5′-TAGAGGGACAAGTGGCGTTC-3′, Reverse primer: 5′-CGCTGAGCCAGTCAGTGT-3′, Invitrogen custom primers) was independently amplified using thermocycling conditions as described in 58 ...
-
Induction of PARP7 Creates a Vulnerability for Growth Inhibition by RBN2397 in Prostate Cancer CellsbioRxiv - Cancer Biology 2023Quote: ... siPARP7 (sense strand 5’-AAUACUCUCAUCGAACGGAAGTT-3’) or si-p21 (sense strand 5-AACAUACUGGCCUGGACUG-3’) using Lipofectamine RNAiMAX (Invitrogen 56532). After 24 hrs of transfection ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were washed after 2 hour treatment in phosphate buffer saline (PBS, Gibco) and fresh growth media was added ...
-
bioRxiv - Genomics 2021Quote: ... and washed twice with 2 ml 1x Dulbecco’s phosphate-buffered saline (DPBS) (Gibco) solution containing 2% fetal bovine serum (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: HEK-293T cells (5×105) were seeded in 2 wells of a 6-well plate in DMEM (Thermo Fisher Scientific #12430054) supplemented with 10% fetal bovine serum (GeminiBio #100-106) ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10−5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 × 10-5 M 2-mercaptoethanol (Gibco, 31350-010), 1X Minimal Essential Medium (MEM ...
-
bioRxiv - Neuroscience 2020Quote: NO production was detected by DAF-FM diacetate (4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate) (D23844, ThermoFisher). Fly larvae were dissected at 24 or 48 h AI in PBS to expose the sensory neurons ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 5% 2-mercaptoethanol] and was resolved by SDS-PAGE on 4% to 12% Bis-Tris gels (Invitrogen). Proteins were transferred to a polyvinylidene difluoride immobilon TM-P membrane (Millipore ...
-
bioRxiv - Immunology 2024Quote: ... we injected the mice intraperitoneally with 4 mg/ml of 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Waltham, MA) with the goal of labeling circulating monocytes to assess macrophage retention among groups ...
-
bioRxiv - Cell Biology 2024Quote: ... 5% v/v 2-mercaptoethanol) and fractionated by 4–12% Bis-Tris gel (Thermo Fisher Scientific Cat#NP0335BOX) using MES running buffer (Thermo Fisher Scientific Cat#NP000202) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 7-Diethylamino-3-(4'-Maleimidylphenyl)-4-Methylcoumarin (CPM) was purchased from Thermo Scientific Life Technologies (Grand Island ...
-
bioRxiv - Biochemistry 2024Quote: ... as was 7- Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen™ D346) and CPM stock was prepared at 5 mg/mL ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...