Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for Recombinant Mouse Folh1 His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... Recombinant human macrophage colony-stimulating factor (CSF1, Gibco-Thermo Fisher, PHC9501) was then added at a final concentration of 100 ng/ml ...
-
bioRxiv - Immunology 2023Quote: ... wiso embryos were injected with a mixture of recombinant Cas9 (Invitrogen) and a gRNA targeting the TotM coding sequence (ACTTATCGTAGAAAGTGACCAGG ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... VEGF ligand (recombinant human protein) was ordered from ThermoFisher (CAT: #PHC9391).
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 ng/uL human IL-6 recombinant protein (ThermoFisher PHC0066).
-
bioRxiv - Cell Biology 2023Quote: ... recombinant bacmid DNA was generated in DH10Bac cells (Thermo Fisher 10361012), and isolated bacmid DNA was transfected into Sf9 cells (a gift from Yifan Cheng ...
-
bioRxiv - Cell Biology 2023Quote: ... Recombinant polyclonal anti-ALDOA antibody cocktail (711764) was purchased from Invitrogen. Goat polyclonal anti-PDGFRβ (sc-1627) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 20 ng/ml human basic FGF recombinant protein (bFGF) (Gibco, 13256029), 2% B27 supplement (Gibco ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 20 ng/ml human EGF recombinant protein (Gibco, PHG0314), 20 ng/ml human basic FGF recombinant protein (bFGF ...
-
bioRxiv - Cell Biology 2024Quote: ... RNaseOUT Recombinant Ribonuclease Inhibitor (40 U/1 µL, Thermo Fisher Scientific), Universal RNA Spike II (0.005 ng/µL ...
-
bioRxiv - Cell Biology 2024Quote: ... and 2.5 ng/mL recombinant human hepatocyte growth factor (Gibco, UK).
-
bioRxiv - Biophysics 2024Quote: Recombinant baculoviruses were produced using the Bac-to-Bac system (Invitrogen) and infected Spodoptera frugiperda (Sf9 ...
-
bioRxiv - Microbiology 2024Quote: ... Recombinant plasmids were transfected into HEK293T cells using Lipofectamine 2000 (Invitrogen) together with lentiviral packaging vectors pMD2.G and psPAX2 (gifts from Didier Trono ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 0.5 uL Taq DNA Polymerase Recombinant (5u/ uL) (Invitrogen, Catalog #10342020), and 0.5 uL dsH2O to a total of 22.5 uL ...
-
bioRxiv - Developmental Biology 2021Quote: ... C2cd6s was subcloned into pcDNA3.1/myc-His A vector (Cat. No. V800-20, Invitrogen). The others were TA-cloned to pcDNA3.1/V5-His TOPO TA vectors (Cat ...
-
bioRxiv - Molecular Biology 2021Quote: ... using the Ion PI™ Hi-Q™ OT2 200 kit (Invitrogen; Cat #A26434) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... incubated with DPBS containing 10% HI FBS and 1:1000 Hoechst 33342 (Invitrogen, #H3570) for nuclear staining and mounted onto microscope cover slips with Fluoromount G (Southern Biotech ...
-
bioRxiv - Microbiology 2020Quote: ... supplemented with 10% heat-inactivated fetal bovine serum [HI-FBS] (Cat#SH30071.03, Thermo Scientific), penicillin [100 IU/ml]-streptomycin [100 ug/ml] (Quality Biological ...
-
bioRxiv - Molecular Biology 2019Quote: ... BAC DNA extraction was performed using Hi-Pure Plasmid DNA Extraction Kit (Invitrogen K210017). Nick translation of BAC DNA was performed using the Nick Translation kit (Roche 11 745 808 910) ...
-
bioRxiv - Molecular Biology 2019Quote: ... full-length MmEsco2 was cloned into the pcDNA3.1/myc-His vector (Thermo Fisher Scientific). Subsequently ...
-
bioRxiv - Microbiology 2019Quote: ... 6×His-Lsr2 was purified by binding to 1 mL Ni-NTA agarose (Invitrogen), after which the resin was collected and the bound protein was washed with binding buffer supplemented with increasing concentrations of imidazole ...
-
bioRxiv - Immunology 2021Quote: ... The extracellular domain of NKp46 was cloned into pcDNA Myc-His 3.1a vector (Invitrogen) or pCMV vector (Addgene plasmid #59314 ...
-
bioRxiv - Bioengineering 2020Quote: ... rabbit monoclonal anti-6x-His tag at 1:1,000 (Thermo Fisher Scientific, MA5-33032), and mouse monoclonal anti-β-actin at 1:10,000 (R&D Systems ...
-
bioRxiv - Molecular Biology 2021Quote: ... The cleared lysate was incubated with 1mL His-Pur nickel-NTA resin (Thermo Fisher) with rotation at 4 °C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... ZAP-S and ZAP-L were subcloned into pEF1-V5/His (Thermo Fisher Scientific) via the KpnI/XbaI sites to generate pEF1-ZAP-S-V5/His and pEF1-ZAP-L-V5/His ...
-
bioRxiv - Neuroscience 2022Quote: ... the pEx-FGD4-His-V5 vector was generated by Gateway cloning technology (Thermofisher, USA). Transfection experiments were performed using promofectin reagent (#PK-CT-2000-50 ...
-
bioRxiv - Immunology 2022Quote: ... unbiotinylated form were incubated with 2μg/mL anti-His biotin (Invitrogen, MA1-21315-BTIN) for 20 min at room temperature before being used to label the streptavidin beads ...
-
Assessment of Human Renal Transporter Based Drug-Drug Interactions Using Proximal Tubule Kidney-ChipbioRxiv - Cell Biology 2022Quote: ... Heat inactivated fetal bovine serum (HI FBS) and trypan blue were procured from Gibco Life Technologies (Waltham ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 10% heat inactivated fetal bovine serum (HI-FBS, Life Technologies unless indicated), 100 U/mL penicillin-streptomycin ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Microbiology 2019Quote: Qst was fused to a His-tag using the pEXP5-CT/TOPO vector (Invitrogen) following the TA-cloning protocol provided by the manufacturer ...
-
bioRxiv - Immunology 2019Quote: ... 1xPen/Strep/Glu and 10% ultralow IgG HI-FBS (Thermo Fisher Scientific, Waltham, MA), and pelleted at 350xg for 5min ...
-
bioRxiv - Biochemistry 2019Quote: ... A full length cDNA of Matriptase constructed in pcDNA3.1-V5-His (Thermo Fisher Scientific) was provided by Dr ...
-
bioRxiv - Molecular Biology 2021Quote: ... Then the blot was incubated with HRP conjugated anti-His antibody (Invitrogen, LOT 1902132) at 1:5000 dilutions for 16h at 40 C ...
-
bioRxiv - Immunology 2021Quote: ... and the protein was purified on His-Pur Ni-NTA resin (Thermo Fisher Scientific) followed by size-exclusion chromatography ...
-
bioRxiv - Microbiology 2020Quote: ... 1U Platinum High Fidelity (Hi-Fi) proof reading Taq polymerase (Invitrogen, Carlsbad, CA, USA). Two colonies of each G ...
-
bioRxiv - Microbiology 2020Quote: ... using the primers shown in Table II and cloned into pcDNA-V5/His (Invitrogen). pCAGGS-EboGP-V5 (strain Zaire 1976 Mayinga ...
-
bioRxiv - Microbiology 2022Quote: Pull-down assays were carried out using Dynabeads His-tag Isolation and Pulldown (Invitrogen). The 6His-tagged soluble pilin domains were used as bait ...
-
bioRxiv - Biochemistry 2022Quote: ... and cultured in house) were grown to 70% confluency in DMEM-Hi glucose (Gibco) supplemented with 10% heat-inactivated foetal bovine serum (Sigma) ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR amplicons were digested and ligated into pcDNA3.1 myc-His B expression vectors (Invitrogen), with a 3xFlag epitope tag also fused to the N-terminus of Ptchd1 ...
-
bioRxiv - Biochemistry 2022Quote: ... redundant anti-His antibody was washed away and 15 μL chemiluminescence substrate (Thermo Scientific) was added onto each well to generate chemiluminescence signal ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 10% heat-inactivated fetal bovine serum (HI FBS, Gibco™ Cat. #10438026) and 1% antibiotic/antimycotic (Gibco™) ...
-
bioRxiv - Plant Biology 2022Quote: ... and purified by Dynabeads™ His-Tag Isolation and Pulldown (ThermoFisher, Catalog number 10103D). DA1 swapped protein ubiquitylation reactions used E1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... incubated for 30 minutes on ice with His-Pur Ni-NTA resin (Thermo Scientific), packed to a height of approximately 5 cm in polypropylene columns ...
-
bioRxiv - Microbiology 2024Quote: ... Supernatant was then processed through a His-tag cobalt resin (ThermoFisher, Waltham, MA, USA) following manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... We then used the Dynabeads His-Tag Isolation and Pull- down kit (ThermoFisher 10103D) to isolate his-tagged Fcy1 following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... and His-p115 were affinity purified using Ni-NTA HisPur beads (Thermo Fisher Scientific) from crude E ...
-
bioRxiv - Microbiology 2023Quote: ... A standard curve of 10-fold dilutions of plasmid pAc5.1-V5-His-A (Invitrogen) containing the DCV ORF-2 sequence was used to convert Ct values to genome copy numbers.
-
bioRxiv - Evolutionary Biology 2022Quote: ... and probed with 6x-His Tag Monoclonal Antibody (HIS.H8) (Thermo Fisher Scientific #MA1-21315) diluted in 5% milk in PBS-T (1:500) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Junction PCR was performed with Extensor Hi-Fidelity PCR Master Mix (Thermo Fisher Scientific) in a 20 μL reaction using 500 nM of target-specific primers and the following cycling conditions ...
-
bioRxiv - Neuroscience 2023Quote: ... and subcloned into the pcDNA™3.1/myc-His(−)A vector (Thermo Fisher Scientific). We accidentally obtained the pcDNA™3.1/myc-His(−)A-(G4C2)9 vector at this step ...