Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for Probable U3 small nucleolar RNA associated protein 11 UTP11 Antibody FITC since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2024Quote: ... The samples were stained with Phalloidin-FITC (Molecular Probes) and DAPI (Molecular Probes ...
-
bioRxiv - Cell Biology 2020Quote: ... BN-PAGE was performed using NativePAGE 3-12% or 4-16% Bis-Tris gels and associated running buffer (Invitrogen). The cathode buffer was supplemented with 0.002% (w/v ...
-
bioRxiv - Developmental Biology 2020Quote: ... The biliary tree fragments and associated stroma were then dissociated into single cells with TrypLE 5x (Gibco, A12177-01), incubated with fluorophore-conjugated antibodies for 30min (see Supplementary Table 1 ...
-
bioRxiv - Microbiology 2020Quote: ... Measurements and analysis were performed using an ABI7500 instrument and associated software package (Applied Biosystems, Foster City, CA, USA).
-
bioRxiv - Developmental Biology 2023Quote: ... a 10-min incubation at RT with streptavidin associated with peroxidase (UltraVision Detection System HRP kit, Thermo Fisher Scientific) was performed ...
-
bioRxiv - Cancer Biology 2024Quote: ... human mammary fibroblast (MF) and cancer associated fibroblast (CAF) were maintained in DMEM/F-12 (Thermo Fisher Scientific, #21331046) supplemented with 2 mM Glutamine (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... The gDNA was quantified using Qubit 2.0 Fluorometer and associated Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific, USA). The quality was assessed by horizonal agarose gel electrophoresis and ImplenNanoPhotometer N60 (Implen ...
-
bioRxiv - Developmental Biology 2023Quote: ... Rho associated kinase inhibitor (10μM, Y-27632) and Geltrex (0.5 μl/cm2 well surface area, Thermo Fisher Scientific, A1413302) were added to media during replating ...
-
bioRxiv - Cell Biology 2024Quote: Adeno-associated viruses for VE-Cadherin proximity labeling experiments were generated using the ViraPower Adenoviral Expression System (Invitrogen, K493000). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Human iPS WT-11 cells were cultured on Vitronectin (Thermo Fisher Scientific) coated 6-well plates or glass coverslips (for smRNA FISH purposes ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Centromeric repeat probes were amplified by PCR using Biotin-11-dUTP (Thermofisher) with primer TCTAGCACTTGTAATCAATCAAATTC and AGAAGTGAGAAGAAAGACTTG ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Neuroscience 2020Quote: ... nonessential amino acids solution (100 μM, Life technologies, Catalog #11-140-050), β-mercaptoethanol (100 µM ...
-
bioRxiv - Biochemistry 2021Quote: ... 11 μg pSPAX2 and 6.4 μg pVSVG using Lipofectamine 2000 (Thermo Fisher). The transfection media was replaced by plating media supplemented with 13 mg/mL bovine serum albumin (BSA ...
-
bioRxiv - Biochemistry 2020Quote: Gateway LR Clonase II Enzyme Mix (Fisher Scientific, Cat. # 11-791-020)
-
bioRxiv - Cell Biology 2021Quote: ... Peptide samples were then reacted with TMT 11-plex reagents (Thermo Fisher) in 40% v/v acetonitrile and incubated for one hour at room temperature ...
-
bioRxiv - Neuroscience 2020Quote: ... -sodium pyruvate media (Cat no. 11-965-092; Gibco by Life Technologies) supplemented with 10% heat-inactive FBS (Cat no.A3840001 ...
-
bioRxiv - Cell Biology 2020Quote: ... collected by centrifugation and resuspended in DMEM/F12 (Gibco, 11-330-057) supplemented with 10% FBS (Sigma ...
-
bioRxiv - Biochemistry 2022Quote: ... and labeled with 11-plex Tandem Mass Tag (TMT) reagents (Thermo Scientific) according to manufacturer’s recommendations.
-
bioRxiv - Cell Biology 2022Quote: ... complete M199 medium consisted of M199 medium (11-150-059, Fisher Scientific), 10% fetal bovine serum ...
-
bioRxiv - Cancer Biology 2022Quote: ... Ovsaho cells (BRCA2 homozygous deleted (11)) were cultured in RPMI-1640 (ThermoFisher) with 10% FBS ...
-
bioRxiv - Microbiology 2021Quote: Desalted peptides were labeled with 11-plex TMT reagents (Thermo Fisher Scientific) and fractionated as described previously (18) ...
-
bioRxiv - Microbiology 2022Quote: ... in two batches of TMT 11-plex (Thermo Scientific, P/N A37724) for the pilot study and ten batches of 16-plex (Thermo Scientific ...
-
bioRxiv - Immunology 2022Quote: ... the cells were incubated with anti-mouse CD4 (11-0041-82, Invitrogen), anti-mouse CD8a (45-0081-82 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and maintained in Dulbecco’s Modified Eagle Medium (Gibco, CAT# 11-965-092) containing 10% heat inactivated fetal bovine serum (BenchMark ...
-
bioRxiv - Biochemistry 2021Quote: Gateway LR Clonase II Enzyme Mix (Fisher Scientific, Cat. # 11-791-020)
-
bioRxiv - Neuroscience 2020Quote: ... -sodium pyruvate media (Cat no. 11-965-092; Gibco by Life Technologies) supplemented with 10% heat-inactive FBS (Cat no.A3840001 ...
-
bioRxiv - Cancer Biology 2022Quote: ... MV-4-11 cells were cultured in Iscove’s Modified Dulbecco’s Medium (Gibco) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2022Quote: ... BaF3 cells were cultured in RPMI 1640 (Fisher Scientific 11-875-119) supplemented with 10% FBS ...
-
bioRxiv - Genomics 2022Quote: ... consisting of 2.5 uM SYTO 11 Green Fluorescent Nucleic Acid Stain (Invitrogen) in cell culture medium was added to each well of a 6-well plate and cells were incubated at 37°C for 60 min ...
-
bioRxiv - Neuroscience 2022Quote: ... was diluted 1:2 in cold F12:DMEM (Gibco, 11-330-057) while on ice to prevent solidification ...
-
bioRxiv - Systems Biology 2024Quote: ... Peptides were labeled with 11-plex tandem mass tag (TMT, Fisher Scientific) reagents following the vendors instructions ...
-
bioRxiv - Bioengineering 2024Quote: ... 1 % (v/v) non-essential amino acids (Gibco, Cat # 11-140-050) 40 µg/mL L-proline (Sigma ...
-
bioRxiv - Microbiology 2023Quote: ... a ProcartaPlex™ 11-PLEX assay kit (ThermoFisher Scientific, Waltham, MA, USA) including GM-CSF ...
-
bioRxiv - Developmental Biology 2023Quote: ... cultivated in 50 ml tubes with BG-11 Growth Media (Gibco, A1379901). Water changes were performed every two weeks ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were fixed with 11% solution containing formaldehyde (Thermo Fisher #28908), 50mM HEPES-KOH (pH 7.5) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a BioTek Synergy H1 plate reader (Fisher Scientific, 11-120-536). SDS-PAGE samples were prepared from the lysates with 5X reducing sample buffer (pH 6.8 ...
-
bioRxiv - Cell Biology 2024Quote: ... HeLa cells were cultured in DMEM (Thermo Fisher Scientific, 11-965-118) supplemented with 10% FBS (VWR ...
-
bioRxiv - Neuroscience 2024Quote: Organ of Corti explants were cultured in DMEM (Gibco, 11-995-065) supplemented with 7% FBS (Gibco ...
-
bioRxiv - Physiology 2024Quote: ... F-11 cells were incubated in Ham’s F-12 Nutrient Mixture (Gibco) supplemented with 20% fetal bovine serum ...
-
bioRxiv - Cell Biology 2024Quote: Flag-ORP9/11 heterodimer was expressed and purified from Expi293 cells (ThermoFisher). To transfect cells ...
-
bioRxiv - Cell Biology 2024Quote: ... 1X MEM Non-Essential Amino Acid (Thermo Fisher Scientific, 11-140-050), 1X GlutaMAX (Thermo Fisher Scientific,) ...
-
bioRxiv - Molecular Biology 2021Quote: ... the antibody-protein-chromatin complex was retrieved by adding 25μl pre-washed Protein G Dynabeads (Thermo Fisher Scientific, 10004D). Immunoprecipitated chromatin DNA was de-crosslinked by 65°C heating overnight using elution buffer (1% SDS ...
-
bioRxiv - Genomics 2020Quote: ... Pooled fractions were tumbled at 4°C for 1 hour with 5μg of antibody (Key Resources Table) and 25μL Dynabeads™ Protein A or Protein G (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Antibody proteins were purified from the culture supernatant after 12-14 days using Protein A bead columns (Thermo Fisher).
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 viral nucleocapsid protein (NP) was detected using the anti-NP protein antibody (PA5-81794, Thermo Fisher) diluted 1:10000 in 0.1% tween-20/1%BSA/PBS solution as a primary antibody ...
-
bioRxiv - Molecular Biology 2020Quote: ... CSDE1 protein was then captured by incubation with an affinity purified CSDE1 antibody conjugated to protein A Dynabeads (Invitrogen) for 4 hours at 4°C with gentle rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... Precipitation of the protein-antibody conjugate was performed incubating with Dynabeads® Protein A (Thermo Scientific, Carlsbad, CA, USA) 40 minutes at 4ºC in a rotary shaker ...
-
bioRxiv - Genomics 2024Quote: ... 5-10 μg of antibody was coupled to 50-100 μl of Protein A or Protein G Dynabeads (Invitrogen). The following antibodies were used ...
-
bioRxiv - Plant Biology 2024Quote: ... The extracted protein was incubated with anti-ZmbZIP75 antibody and Pierce™ protein A Magnetic Beads (Thermo Scientific; #88802) at 4 °C for 4 h with gentle agitation ...