Labshake search
Citations for Thermo Fisher :
1151 - 1200 of 10000+ citations for Killer cell immunoglobulin like receptor 2DL3 KIR2DL3 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... All human CD8+ T cells were activated with anti-human CD3/CD28 dynabeads (11131D, Thermo Scientific) at a 1:1 cell-to-bead ratio and cultured in complete RPMI supplemented with 10% FBS ...
-
bioRxiv - Immunology 2024Quote: Fresh human BAL cells and frozen human PBMCs were stained with Aqua live/dead dye (Invitrogen) for 20min at room temperature ...
-
bioRxiv - Immunology 2023Quote: ... Primary human T cells were thawed and activated with Human T-Expander CD3/CD28 Dynabeads (Gibco) at a 3:1 bead:cell ratio in complete medium (RPMI 1640 supplemented with 10% fetal bovine serum ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Jurkat T cells and human THP-1 monocytes were cultured in RPMI 1640 medium (ThermoFisher), supplemented with 10% FBS ...
-
bioRxiv - Biophysics 2020Quote: HeLa and HEK293 cells were cultured at 37°C in an atmosphere of 5% CO2 in air in DMEM (Gibco, #10566024) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Developmental Biology 2021Quote: HEK293 and A375 (ATCC CRL-1619) cells were maintained in Dulbecco’s Minimum Essential Media (DMEM) (Gibco, Life Technologies, Carlsbad, CA, USA), containing L-glutamine ...
-
bioRxiv - Genomics 2020Quote: ... 10 ng of the library were transfected into 250 000 HEK293 cells in one well of a 6-well plate using Lipofectamine 2000 (11668027, ThermoFisher Scientific) and OPTIMEM I Reduced Serum Medium (31985-047 ...
-
bioRxiv - Biophysics 2019Quote: HEK293 cells were grown in 1:1 Dulbecco’s Modified Eagle’s Medium (DMEM)/F-12 Ham with Glutamax+ (ThermoFisher Scientific, Waltham, MA) supplemented with 10% fetal bovine serum (Alkali Scientific ...
-
bioRxiv - Biochemistry 2020Quote: ... The P2 baculovirus produced in Sf9 cells was added to HEK293 GnTI- cells (mycoplasma test negative, ATCC #CRL-3022) and grown in suspension in FreeStyle medium (GIBCO-Life Technologies) supplemented with 2% FBS at 37°C and 8% CO2 ...
-
bioRxiv - Neuroscience 2021Quote: ... Recombinant vectors were transfected in HEK293 cells with 10 nM of miRNA mimics (miR-3594-5p, mature sequence: CCCAGGGCAGAGCAGUGUGAA; miR-negative control, ThermoFisher scientific) with Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: ... HEK293 cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, USA), penicillin ...
-
bioRxiv - Microbiology 2020Quote: All transfection experiments were performed in HEK293 FT and cell lines using an optimized Lipofectamine 3000 transfection protocol (Life Technologies, L3000015). For RNA silencing in 293 HEK ...
-
bioRxiv - Microbiology 2020Quote: HEK293 FT (ATCC CRL-3216) and VERO (ATCC CCL-81) cell lines were cultured in DMEM high glucose media (Life Technologies) containing 10% heat-inactivated fetal bovine serum (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: All E2 cores (E2c3, E2mc3, and E2mc3 v1-v10) and E2p-based nanoparticles were transiently expressed in HEK293 F cells (Thermo Fisher) for biochemical ...
-
bioRxiv - Immunology 2021Quote: ... IgGs and 6xHis-tagged Fabs were expressed by transient transfection of paired heavy chain and light chain expression plasmids into HEK293-6E or Expi293 cells (Life Technologies). Fabs and IgGs were purified from transfected cell supernatants using Ni-NTA (GE Healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... NP presenting BG505 V1V2 and a trimeric scaffold (1TD0) presenting ZM109 V1V2 were transiently expressed in N-acetylglucosaminyltransferase I-negative (GnTI-/-) HEK293S cells (Thermo Fisher) (41) ...
-
bioRxiv - Biochemistry 2021Quote: ... 293 cells from a pMLINK tetracistronic vector (courtesy of Y. Shi, Tsinghua University, Beijing).45 HEK293 cells were cultured in Freestyle 293 media (Life Technologies), shaking at 125 rpm while incubating at 37 oC with 8% CO2 until a density 2 × 106 cells/ml was reached ...
-
bioRxiv - Immunology 2021Quote: HEK293 cells were transiently transfected with SARS-CoV-2-S fragments expression vectors using Lipofectamine 2000 Transfection reagent (Thermo Fisher Scientific). Two days later ...
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 S gene containing plasmid p20017 and adenovirus backbone plasmid pAADV-C01 (Genemedi, China) were co-transfected into HEK293 based adapted viral production cell (ThermoFisher, USA). Viral production cells were seeded in a 6 well TC treated plate (Nest ...
-
bioRxiv - Cancer Biology 2022Quote: ... LCV2-GFP or LCV2-RFP were mixed with sPAX2 and MD2.G plasmids and transfected in HEK293 cells using Lipofectamine 2000 (Life Technologies). After 24h ...
-
bioRxiv - Neuroscience 2022Quote: SARS-CoV-2 Spike proteins (recombinant SARS-CoV-2 Spike Protein (SP-RBD, Arg319-Phe 541; cat# RP-87678, HEK293 cell expressed and binds ACE2) was obtained from Life Technologies Corporation ...
-
bioRxiv - Developmental Biology 2024Quote: Cultured HEK293 cells were grown on 12 mm round cover glasses (Azer Scientific, #200121) pre-coated with poly-D-lysine (Gibco, #A3890401) in 24-well plates and then transfected with a plasmid encoding HA-tagged neurexin1 alpha using lipofectamine 2000 ...
-
bioRxiv - Immunology 2024Quote: ... We electroporated 3 μg of ODNs or gDNA into 2 × 106 HEK293 and 293A cells by Neon Transfection System (Thermo Fisher) based on the manufacturer’s introductions.
-
bioRxiv - Cancer Biology 2023Quote: ... Constructs carrying the 3’UTRs were transiently co-transfected with vectors carrying Renilla-Luciferase and either miR-122 mimic (122-MIM) or scramble oligos (SCR) into HEK293 cells with Lipofectamine RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2023Quote: HEK293 cells were harvested and lysed in RIPA lysis with 1X Halt™ Protease and Phosphatase Inhibitor Cocktail (Thermo Fisher Scientific). The concentration of total protein was determined using the BCA Protein Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... and human embryonic kidney 293 cells (HEK293) were purchased from ATCC and cultured in Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Fisher Scientific, #MT10013CV) with 10% FBS at 37 °C and 5% CO2 ...
-
bioRxiv - Molecular Biology 2023Quote: Approximately 4 × 106 HEK293 Flp-In T-Rex cells with EGFP integrants were seeded in 15-cm dishes (Thermo Fisher Scientific) and incubated overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... Flp-In HEK293 cells were co-transfected with the pCDNA3-TurboID-cyclin F plasmid and the pOG44 Flp-Recombinase Expression Vector (Invitrogen, V600520) for co-expression of the Flp-recombinase using Lipofectamine 2000 transfection reagent (Invitrogen ...
-
bioRxiv - Molecular Biology 2020Quote: ... HEK293T (Human Embryonic Kidney cells 293) cells were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2021Quote: ... Sorted human MAIT cells and T cells were cultured in IMDM (Gibco) supplemented with 5% pooled human serum (NHS Blood and Transplant Unit) ...
-
bioRxiv - Immunology 2022Quote: ... Dead cells were excluded using ThermoFisher LIVE/DEAD Fixable Aqua Dead Cell Stain and binding to Fc receptors was blocked using CD16/CD32 (clone 93, eBioscience/ThermoFisher). Absolute cell numbers were calculated using counting beads (123count eBeads ...
-
bioRxiv - Immunology 2019Quote: ... and cells stably expressing the receptors of interest were selected and cultured in the presence of 800 µg/ml G418 (Invitrogen). The human embryonic kidney cell line HEK293T (CRL-3216 ...
-
bioRxiv - Neuroscience 2020Quote: ... The pCAG-DCC:TDTOMATO wildtype and missense mutant receptor constructs (0.2 µg) were transfected into COS-7 cells using Lipofectamine® 2000 (Invitrogen). After 48 hours ...
-
bioRxiv - Neuroscience 2020Quote: The pCAG-DCC:TDTOMATO wildtype and missense mutant receptor constructs (0.2 µg) were transfected into COS-7 cells using Lipofectamine® 2000 (Invitrogen). After 48 hours ...
-
bioRxiv - Microbiology 2022Quote: ... cells and baby hamster kidney 21 cells expressing the MHV receptor (BHK-R)(47) were maintained in DMEM containing 10% FBS (Invitrogen), 100 U/ml penicillin ...
-
bioRxiv - Immunology 2020Quote: Up to 5×106 isolated cells were incubated for 30 min at 4 °C with anti-CD16/CD32 (Fc receptor) clone 93 (Invitrogen) to block non-specific binding and with fixable viability dye eFluor455UV (eBioscience ...
-
bioRxiv - Biochemistry 2020Quote: ... , S1 subunit mutants and the extracellular domain of ACE2 receptor (GenBank NM_021804.3) were Baculovirus-free produced in High Five cells (Thermo Fisher Scientific) by transient transfection as previously described in Bleckmann et al ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: CHO cell lines overexpressing FPR2 and FPR1 receptors were generated in-house and propagated in Ham’s F12 medium (Gibco Biosciences) supplemented with 10% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... 293T-hACE-2 (BEI resources, NIH, Catalog No. NR-52511) cells expressing the ACE2 receptors were cultured in DMEM (Gibco) supplemented with 5% FBS (Fetal Bovine Serum) ...
-
bioRxiv - Molecular Biology 2021Quote: ... fluorescence-labeled HIV-1JR-FL Env(-) carrying the (His)6 epitope tag was incubated with biotin-conjugated anti-(His)6 tag antibody (HIS.H8, Invitrogen) at 4° for two hours.
-
bioRxiv - Cell Biology 2019Quote: ... The plasmids encoding for His-SEPT2 or His-SEPT2-mCherry and SEPT6/7-strep were co-transformed into E.coli BL21 (DE3) (Invitrogen). Bacterial cultures were grown to OD600 of 2-3 and induced with 1 mM IPTG for 1h at 37°C (His-SEPT2 ...
-
bioRxiv - Immunology 2021Quote: ... RBD-His and Spike-his containing supernatants were batch purified using the HisPur™ Ni-NTA Resin (ThermoFisher Scientific). Supernatants were incubated with 6 ml of resin for 1h at RT ...
-
bioRxiv - Microbiology 2020Quote: ... We then resuspended the cell pellet in 9.5mL PBS/2%HI-FBS for counting using the Countess Cell Counting system (Thermo Fisher Scientific). We aliquoted 0.5 mL for Seq-Well ...
-
bioRxiv - Molecular Biology 2021Quote: 10,000 HEK293 FRT were seeded in 96 well plates (M33089, ThermoFisher UK) and induced with tetracycline for 24 hours ...
-
bioRxiv - Cell Biology 2022Quote: NIH-3T3 (ATCC: CRL-1658) and HEK293-FT (HEK, ThermoFisher Scientific R70007) were maintained in Dulbecco’s Modified Eagle Medium (DMEM) ...
-
bioRxiv - Genetics 2021Quote: ... The plasmids were used to generate Flp-In HEK293 (Thermofisher, cat. #R78007) stable cell lines ...
-
bioRxiv - Bioengineering 2019Quote: A transgenic HEK293 containing GFP gene in the genome (ThermoFisher via MTA) was used in cell experiments ...
-
bioRxiv - Molecular Biology 2023Quote: The parental Jump-In™ HEK293 (Thermo Fisher Scientific, hereafter termed HEKR4) and all its derivatives were grown in medium containing DMEM (Invitrogen ...
-
bioRxiv - Cell Biology 2024Quote: Flp-In TMT-REXTM HEK293 were cultured with DMEM-GlutaMAXTM media (Gibco) supplemented with 10% FBS (Gibco) ...