Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for 7 Chloro 9 methyl 3 4 dihydro 2H benzo b oxepin 5 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Cells were passaged every 3-4 days using 0.05% Trypsin-EDTA solution (Gibco).
-
bioRxiv - Immunology 2021Quote: ... cells were incubated in 2-(N-(7-nitrobenz-2-oxa-1,3-diaxol-4-yl) amino)-2-deoxyglucose (2-NBDG) (Invitrogen) (20 µM ...
-
bioRxiv - Physiology 2021Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in saline solution at 5 mg/ml ...
-
bioRxiv - Cancer Biology 2020Quote: ... (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG) (100 μM; ThermoFisher Scientific) with Hoechst (1 μg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and 2-NDBG [2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose] (N13195) were purchased from Invitrogen. Recombinant murine SCF (250-03) ...
-
bioRxiv - Pathology 2019Quote: The infected rice sheaths were incubated with CellTracker™ Blue CMAC Dye (7-amino-4-chloromethylcoumarin, Molecular Probes, C2110) at a final working concentration of 10 μM for 2 h at 37 °C ...
-
bioRxiv - Physiology 2019Quote: ... 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG, Thermo Fisher Scientific, USA) was dissolved in PBS at 5 mg/ml ...
-
bioRxiv - Immunology 2020Quote: ... Glucose uptake assay was performed by incubating cells with 50 µM 2-NBDG (2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose) (Invitrogen) for 90 min at 37°C prior to cell staining ...
-
bioRxiv - Biochemistry 2019Quote: ... 7 μl of Superscript III reverse transcription master mix (containing 4 μl of 5x First Strand Buffer (Life Technologies), 1 μl of 100 mM DTT ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stained with 250 μM Cell Tracker Blue CMAC (7-amino-4-chloromethylcoumarin) dye (Life Technologies, Carlsbad, CA). Cells were then plated onto 35 mm glass bottom microwell dishes that were poly-d-lysine coated (MatTek Corporation ...
-
bioRxiv - Immunology 2022Quote: ... cells were resuspended in glucose-free media containing 150 μM 2-(N-(7-Nitrobenz-2-oxa-1,3-diazol-4-yl)Amino)-2-Deoxyglucose (2-NBDG Thermofisher) and incubated for 45 minutes at 37°C.
-
bioRxiv - Cell Biology 2024Quote: Cells cultured for 4 days at a starting density of 7 x 104/cm2 were lysed in TRIzol (Ambion) for 5 min and transferred to an RNA-free microcentrifuge tube following manufacturer recommendations ...
-
bioRxiv - Neuroscience 2023Quote: Organ of Corti explants were dissected at postnatal day 4 through 7 (P4-P7) in Leibovitz’s L-15 cell culture medium (Invitrogen), containing the following inorganic salts (in mM) ...
-
bioRxiv - Cell Biology 2024Quote: ... A final concentration of 10 μM Cell Tracker Blue CMAC (7-amino-4-chloromethylcoumarin) dye (Life Technologies; Carlsbad, CA) and 1 μM of MG-TAU dye (cell permeant dye αRed-np1 ...
-
bioRxiv - Genomics 2021Quote: ... One-step reverse transcription and real-time PCR was performed with a Quantstudio 5 (Thermo Fisher Scientific) using Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Step one: wells were blocked for 1 hour in 80uL of 5% Blocker BLOTTO (ThermoFisher Scientific, #37530). Step two ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50,000 4T1 cells were injected and mice treated with either 1 or 3 doses of 8 mg/kg carboplatin or vehicle by tail vein injection staggered by one day with anti-VEGFR3 antibody (100 μg per injection × 3 total injections, I.P., eBioscience (now ThermoFisher), Control IgG ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified by real-time PCR with SYBR Green (DotScientific) using the one-step protocol QuantStudio 3 (ThermoFisher Scientific). Relative expression was calculated using the ΔΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified by real-time PCR with SYBR Green (DotScientific) using the one-step protocol QuantStudio 3 (ThermoFisher Scientific). Relative genomes were calculated using the ΔCT method ...
-
bioRxiv - Microbiology 2020Quote: ... one for virus quantitation (TCID50) and the other for vRNA extraction in TRIzol (ThermoFisher, 15596026; 1 in 3 dilution). Samples were stored at -80°C until required ...
-
bioRxiv - Immunology 2024Quote: ... One cm pieces of small intestine were then incubated in HBSS containing 3 mM EDTA and 7.5% FBS (ThermoFisher) for 1 hour in a shaker at 37° C ...
-
bioRxiv - Genomics 2023Quote: ... One microliter of each cDNA sample was used for TaqMan PCR (Eppendorf RealPlex Mastercycler and Applied Biosystems QuantStudio 3) with 50 heating cycles at 94°C for 30 seconds ...
-
bioRxiv - Microbiology 2020Quote: Treated and untreated biofilm-containing pegs after a 24-hour incubation in MMBC-3 were subjected to microscopic imaging after staining with 5 μM of Syto®9 green-fluorescent nucleic acid stain (Invitrogen, ThermoFisher Scientific) diluted in PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... diluted cell supernatant was preabsorbed for one hour at 4°C with protein A/G magnetic beads (Invitrogen). The supernatant fraction was incubated overnight at 4°C with an appropriate antibody and protein A/G magnetic beads were blocked with 4% BSA ...
-
bioRxiv - Molecular Biology 2020Quote: One hundred micrograms of mitochondrial proteins were separated on 4-16% (w/v) polyacrylamide Native PAGE gels (Invitrogen) and then either transferred to PVDF membranes or subjected to in-gel activity staining as in previously described in (25) ...
-
bioRxiv - Microbiology 2022Quote: ... A total of 4 μg of RNA was treated with one unit of DNase I Amplification Grade (Invitrogen) to remove potential contamination with genomic DNA ...
-
bioRxiv - Microbiology 2022Quote: ... Eluted protein complexes were separated by one-dimensional 4-12% NuPage Novex Bis-Tris Gel (Invitrogen, Cat. NP0321BOX) and stained using the Colloidal Blue Staining Kit (Invitrogen ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Immunology 2022Quote: ... mice were fasted overnight and then gavaged with 100 μl of rhodamine B-dextran (5 mg/ml; ThermoFisher) in 2% methylcellulose ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM KCl) and then supplemented with 5% (v/v) B-PER Bacterial Protein Extraction Reagent (Thermo Scientific) before sonication ...
-
bioRxiv - Biophysics 2024Quote: ... which is the same medium as above with 5 μg·ml-1 hygromycin B (Thermo Scientific Chemicals, J60681-MC) replacing the zeocin.
-
bioRxiv - Molecular Biology 2023Quote: ... 5 μL of Fraction B supernatants and pellets were loaded onto NuPAGE 10% Bis-Tris gels (Life Technologies) and were run at 150 V for 60 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... followed by two 5-min washing steps with washing buffer B (2X SSC and 10% formamide, Ambion; AM9342). In a humidified chamber ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Bioengineering 2023Quote: Passage 3 and passage 4 cells from 8 donors (4 male and 4 female) were expanded in T175 flasks (Thermo Fisher Scientific, Hampton, New Hampshire USA) and were cultured until passage 5 (p3-5 and p4-5 ...
-
bioRxiv - Biochemistry 2020Quote: ... The transfection mixture for HEK293T cells was created by adding 9 μL Lipofectamine™ LTX Reagent with 3 μL PLUS™ Reagent (Thermo Scientific #15338100) and 3 μg of a plasmid to 500 μL Opti-MEM™ (Thermo Scientific #31985062) ...
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded in microglia differentiation medium with 3 μM Fluo-4 AM and 3 μM Fura-Red AM (Molecular Probes) in the presence of Pluronic Acid F-127 (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocks of tissue of ~3×3×4 cm (depth×width×height) were cut and prepared for sectioning using a Vibrating Blade Microtome (Thermo Fisher) at a thickness of 500μm ...
-
bioRxiv - Cell Biology 2021Quote: ... Daily media changes were performed up to day 9 when cells were fixed with 100% ice-cold Methanol (Fisher Scientific, cat # A454-4). Images were acquired on a Nikon Instruments Ti2 inverted fluorescence microscope ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
A sound strategy for homology modeling-based affinity maturation of a HIF-1α single-domain intrabodybioRxiv - Biochemistry 2020Quote: The HIF-1α-PAS-B domain was coated at 3 μg/ml onto 96-well microtiter plates (Thermo Fisher Scientific) and incubated overnight at 4 °C ...
-
bioRxiv - Biophysics 2020Quote: ... DiIC18(1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindotri-carbocyanine Iodide) and the Alexa 488-labeled fragment B of cholera toxin were purchased from Thermo Fisher scientific (Waltham ...