Labshake search
Citations for Thermo Fisher :
1101 - 1150 of 10000+ citations for 6 Methyl 2 3 4 9 tetrahydro 1H carbazol 1 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Immunology 2021Quote: ... was added to a concentration of 1X and 12.5-30 μg of total protein from each sample was resolved on NuPAGETM 4-12% BisTris (Phospho-PMK-1 and Total-PMK-1) or NuPAGETM 3-8% TrisAcetate (TIR-1::3xFLAG) gels (ThermoFisher Scientific), transferred to nitrocellulose membranes using a Trans-Blot Turbo Transfer System (Bio-Rad Laboratories ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2023Quote: ... coli DH5α or One Shot® ccdB SurvivalTM 2 T1R (Invitrogen) for plasmids containing the ccdB containing Gateway cassette were used.
-
bioRxiv - Cell Biology 2020Quote: ... and then loaded with fluorescent Ca2+ probes (3 μM of fura-2 AM or 5.69 μM of Fluo-4 AM, Life Technologies) in HBSS for 30 minutes at 37°C ...
-
bioRxiv - Neuroscience 2020Quote: ... third instar larvae were dissected in zero Ca2+ HL-3 solution at room temperature and stimulated with a HL-3 solution of 90 mM K+/2 mM Ca2+/4 μM FM4-64 (Invitrogen) for 5 min to load FM4-64 dye into the boutons ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were treated with RNAScope H2O2 for 4 min at RT and subsequently washed 2 x 3 min with UltraPure Distilled Water (Invitrogen) at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... were crossed for 2-3 days and then transferred to fly food made from 0.6 g of Carolina Formula 4-24 (Fisher Scientific) and 2 mL of ddH2O ...
-
bioRxiv - Biophysics 2022Quote: ... N-(7-Nitrobenz-2-Oxa-1,3-Diazol-4-yl)-1,2-Dihexadecanoyl-sn-Glycero-3-Phosphoethanolamine (NBD-PE) was purchased from ThermoFisher (Waltham, MA). Cholesterol Oxidase from Streptomyces was purchased from MP Biomedicals (Santa Ana ...
-
bioRxiv - Genomics 2024Quote: ... and transfer plasmids were transfected at a mass ratio of 2:3:4 with Lipofectamine 3000 (Thermo Fisher Scientific L3000001) following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Developmental Biology 2019Quote: ... One-third to one embryo equivalents were loaded at per lane on 4%-12% or 8% Bolt® Bis-Tris (Invitrogen). GFP Rabbit IgG Polyclonal Antibody (Molecular Probes ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Microbiology 2021Quote: ... L454W/E455G and S262R) and mCherry (6:4:1 mixtures; 2.2 μg/well) using Lipofectamine® 2000 (Invitrogen), according to the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2022Quote: ... and pGL4.74-Renilla luciferase plasmids in a ratio of 0.5:1:0.1 (4 μg/6-well dishes) using Lipofectamine LTX PLUS (Invitrogen). The luciferase activity was assayed using the Dual-Luciferase Reporter Assay Kit (Promega) ...
-
bioRxiv - Cell Biology 2024Quote: ... we used 1-(4-Trimethylammoniumphenyl)-6-Phenyl-1,3,5-Hexatriene p-Toluenesulfonate (TMA-DPH; Thermofisher Scientific Cat. No. T204). Yeast cells were stained with 0.5µM TMA-DPH ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and 100 μg mL−1 hygromycin (31282-04-9, ≥98%, Invitrogen). Cells were split 1:5 when confluency reached 70% and discarded after passage 10 ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Neuroscience 2019Quote: ... harbouring the full-length cDNA coding for the human muscle 6-phosphofructo-1-kinase muscle isoform (PFK1-M)3 (accession number, NM_000289.1) using Lipofectamine LTX-PLUS Reagent (Life Technologies) according with manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100 μl of N-methyl-N-trimethylsilyl trifluoroacetamide (MSTFA, Pierce) with 1% trimethylchlorosilane (1% TMCS, Thermo Scientific) was added to react for 30 min in 60°C ...
-
bioRxiv - Cell Biology 2022Quote: ... metaphase II-arrested eggs were microinjected with 2-3 picolitres of Rec8 antiserum (13) (1:2 dilution) and Alexa Fluor 488 Dextran 10,000 MW (Molecular Probes, D22910; 1:40 dilution) in 0.05% (v/v ...
-
bioRxiv - Neuroscience 2022Quote: ... psPAX2 and pMD2.G with a ratio of 4:3:1 in Opti-MEM (Gibco, 31985070) using Lipofectamine 2000 (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... with 1 ml per 4 million cells of 3 mM disuccinimidyl glutarate (DSG) (ThermoFisher Scientific, 20593) for 40 min at room temperature and quenched by 0.4 M Glycine for 5 min ...
-
bioRxiv - Microbiology 2023Quote: ... 3% sucrose) diluted 1:4 in Leibovitz’s L-15 medium without phenol red (Gibco, Waltham, MA) and an adjusted osmolality of 340 mOsm using 1 M sucrose ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The transfection reagent was mixed with the pOG44 Flp-Recombinase expression vector and the pCDNA5/TO/FRT-3xMyc-eGFP-CLIP-170 WT or one of the mutant vectors with a 3:1 ratio in Opti-MEMTM I medium (Gibco, ThermoFisher Scientific). Selection started 48h after the transfection in a Dulbecco’s modified Eagle medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... the PCR products from either primer pairs 6/7 or 9/10 with the plasmid vector pCR 2.1 (Thermo Fisher) followed by transformation of One Shot Top 10 chemically competent cells (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2023Quote: ... The precipitated pellets containing the cumulus-oocyte complexes (COCs) were transferred to a 9 cm Petri dish and 6 ml of wash medium (TCM 199 - GIBCO, buffered with 2.5% HEPES ...
-
bioRxiv - Cell Biology 2024Quote: Protein concentrations of samples (fractions 6-9) were determined with a Pierce™ BCA Protein Assay Kit (ThermoFisher, Rockford, USA), and Bradford assay (Biorad ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Microbiology 2021Quote: ... were three-fold diluted (ranging from 1:9 to 1:243) in DMEM (Gibco) supplemented with 10% heat-inactivated FCS (Gibco) ...
-
bioRxiv - Microbiology 2024Quote: ... The biofilm was fixed with 4% paraformaldehyde and stained with SYTO 9 fluorescent dye (Thermo Fisher Scientific). Z-stack images were captured on the Olympus FluoView FV1200 confocal microscope ...
-
bioRxiv - Physiology 2022Quote: ... 60 μL of N-methyl-N-trimethylsilyltrifluoracetamide (MSTFA with 1%TMCS, ThermoFisher Scientific #TS48913) was added automatically via the auto sampler and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 1:100 Culture One (ThermoFisher #A33202-01). Depending on the length of the experiment ...
-
bioRxiv - Microbiology 2020Quote: ... colonies were stained using 500 µl of GC medium containing 3 µmol/l Syto 9 (Thermo Fisher Scientific) and 4.5 µmol/l propidium iodide (PI ...
-
bioRxiv - Cell Biology 2022Quote: ... Breg adenovirus-transduced brown adipocytes were cultured in serum-free medium with 1× protein transport inhibitor cocktail (10.6 µM Brefeldin A and 2 µM Monensin) (Fisher scientific, #50-930-9), 10 µM oligomycin ...
-
bioRxiv - Molecular Biology 2021Quote: ... One 6-well plate per reporter to the tested was transfected using RNAiMax transfection reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... MDCK II cells were seeded in tandem one set on a 6 well plate (Thermofisher, 140675) at 28,000 cell density (for qPCR analysis ...
-
bioRxiv - Biochemistry 2020Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotech ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were passaged every 4-6 days with Versene solution (Gibco). A control iPS cell line (MIN09i-33114.C ...
-
bioRxiv - Physiology 2020Quote: ... and sectioned (4-6 micron) using a Microm HM 325 (ThermoFisher). Tissue sections were then stained with Weigert’s iron hematoxylin and Masson Trichrome (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2020Quote: ... 4 µg plasmid and 6 µl Turbofect (Thermo Fisher Scientific, USA) were combined ...
-
bioRxiv - Neuroscience 2024Quote: ... the sections were labeled with DAPI (4’,6-diamidino-phenylindole, Invitrogen) and subsequently mounted onto a glass slide and cover-slipped using an antifade mounting medium.
-
bioRxiv - Cell Biology 2024Quote: ... passaged every 4-6 days with Versene solution (Thermo Fisher Scientific) and cultured in StemMACS iPS-Brew XF medium (Miltenyi Biotec ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated 1h at room temperature with Alexa Fluor-conjugated secondary antibodies at 1:1,000 (ThermoFisher), washed 3 times in PBS and counterstained with DAPI at 1 μg.mL−1 in PBS before mounting.