Labshake search
Citations for Thermo Fisher :
1051 - 1100 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... Mitochondrial proteins were solubilized with 1% digitonin resolved on 4-16% or 3-12% NativePAGE Novex gels (Invitrogen). For blotting ...
-
bioRxiv - Cell Biology 2020Quote: ... incubated 2-3 minutes with SuperSignalTM West Pico Chemiluminiscent Substrate (Thermo Scientific) and imaged using C-DiGit® Blot Scanner (LI-COR).
-
bioRxiv - Biochemistry 2021Quote: ... A predesigned TaqMan assay targeting exon 2–3 boundary (Hs00213726_m1; Life Technologies) was also used to ensure equal amount of the endogenous A4GALT transcript in transfected and non-transfected cells ...
-
bioRxiv - Cell Biology 2021Quote: ... Jade1/2/3 mRNA was assessed by SYBR Green (Thermo Fisher Scientific) qPCR using Hprt1 as endogenous control ...
-
bioRxiv - Cell Biology 2021Quote: ... and were passaged every 2 or 3 days using 0.05% Trypsin (Gibco). mESCs were used at passages below 30 ...
-
bioRxiv - Neuroscience 2020Quote: ... Fibroblasts were fed every 2-3 days with DMEM (ThermoFisher Scientific, #11995073) media supplemented with 10% (v/v ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were passaged once every 2-3 days by trypsinization (Gibco, 25300054) upon reaching ∼70-80% confluency ...
-
bioRxiv - Physiology 2020Quote: ... for 3 days with macrophage-conditioned medium containing 2% Horse Serum (Gibco). Cells were washed ...
-
bioRxiv - Cell Biology 2020Quote: ... spiked with 2-3 μL Plus reagent (15338100, Thermo Fisher Scientific, USA). The plasmid solution was mixed and incubated for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were split every 2 to 3 days using TrypLE Express (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... and TaqMan assay reagents (Table 2) on the QuantStudio 3 (Applied Biosystems). Gene expression was normalized to GAPDH expression ...
-
Self-organised pattern formation in the developing neural tube by a temporal relay of BMP signallingbioRxiv - Developmental Biology 2023Quote: Cells were passaged every 2-3 days by incubation with Accutase (Gibco) for 2-3 min at 37°C ...
-
bioRxiv - Pathology 2022Quote: ... 2 and 3 were quantified using CyQUANT Proliferation Assay Kit (Invitrogen, C35011); For myofibroblast differentiation assay ...
-
bioRxiv - Molecular Biology 2023Quote: ... Dynabeads with precipitated proteins were washed 3 times with DynaMag-2 (Invitrogen) and eluted with LDS buffer (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... 3) Dyes: NucBlue Live Cell Stain (2 drops/ml, R37605, Molecular Probes), phalloidin-568 (A12380 ...
-
bioRxiv - Genetics 2024Quote: ... transfected cells were selected using 2-3 µg puromycin (Thermo Fisher Scientific) until all cells in non-transfected control were dead ...
-
bioRxiv - Neuroscience 2024Quote: ... This medium was exchanged 2-3 hours after plating with Neurobasal (Gibco) supplemented with L-glutamine (2 mM) ...
-
bioRxiv - Cell Biology 2024Quote: ... hansenii cells were concentrated 10x in 200 μL YPD containing 40 μM FM4-64 dye (N-(3-Triethylammoniumpropyl)-4-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) dye (Invitrogen™) to label endosomes for 8 minutes ...
-
bioRxiv - Cell Biology 2024Quote: ... 500 μM triazole ligand Tris[(1-benzyl-1H-1,2,3-triazol-4-yl)methyl]amin (TBTA, Thermo Fisher Scientific, 454531000), 62.5 μM biotin-alkyne tag (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... 25mM HEPES (2(−4-(2-hydroxyethyl)-1-piperanzinyl) ethansulfonacid) and supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco, ThermoFisher Scientific), 10.000 U/mL (v/v ...
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Cell Biology 2024Quote: ... 200 nM MCPH1-5’-CUCUCUGUGUGAAGCACCUdTdT-3’) in serum-Free Opti-MEM medium (Gibco). The transfection controls were set up as above but without adding the siRNA oligos ...
-
bioRxiv - Microbiology 2024Quote: ... 5’-TATTGGTCTCAGGGAGCGAAAGCAGG 3’ using Superscript III according to the manufacturer’s protocol (Invitrogen, #18080400).68 PCRs were performed to amplify and append partial Illumina i5 and i7 adapter sequences across four sub-amplifications of each library to sequence the entire vRNA genome ...
-
bioRxiv - Biophysics 2021Quote: ... Nucleus were stained with DAPI (4’, 6-diamidino-2-phenylindole, Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA was stained with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen). After washing with PBS ...
-
bioRxiv - Neuroscience 2020Quote: Primary cortical neurons were loaded with 2 µM Fluo-4 (Invitrogen) in KRH (Krebs’–Ringer’s–HEPES containing (in mM) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cultures were loaded with 2 µM Fluo-4 AM (Thermo Fisher) in Neurobasal-A media supplemented with B27 without phenol red for 30 minutes at 37°C in a 5.5% CO2 atmosphere ...
-
bioRxiv - Bioengineering 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (D1306; Life Technologies, Carlsbad, CA) and Alexa Fluor™ 568 Phalloidin (phalloidin ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 μg/ml 4′,6-diamidino-2-phenylindole (DAPI, Life Technologies) was used to stain nuclei.
-
bioRxiv - Molecular Biology 2022Quote: ... and nuclei stained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen). Mowiol was used as mounting medium.
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Immunology 2022Quote: ... with DAPI (4’,6-diamidino-2-phenylindole) (Invitrogen™, Thermo Fisher) on microscope slides ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Cancer Biology 2022Quote: ... nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 0.1% stock diluted 1/500 in PBS for use ...
-
bioRxiv - Neuroscience 2021Quote: ... The fluorescent stain 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, P36931) and GFP were used to detect nuclei and α-syn accumulations ...
-
bioRxiv - Neuroscience 2020Quote: ... Larvae were counterstained with 4’,6-diamidino-2-phenylindole (DAPI) (ThermoFisher) for 30 minutes.
-
bioRxiv - Neuroscience 2022Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific D1306). Sections were imaged with a slide scanning confocal microscope.