Labshake search
Citations for Thermo Fisher :
951 - 1000 of 10000+ citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2021Quote: ... The cells were loaded with 5 μM fluo-4 AM (Invitrogen) in Hanks’ balanced salt solution (HBSS ...
-
bioRxiv - Cell Biology 2023Quote: ... 4-5 μl Page Ruler Pre-stained Protein Ladder (Thermo Scientific), and 10 μl of 4X Dye (last three grooves ...
-
bioRxiv - Cancer Biology 2024Quote: ... Excess cells were washed off with PBS (4×5 mL, Gibco), briefly left in RPMI (5 mL ...
-
bioRxiv - Microbiology 2024Quote: ... 4 µl of T4 DNA ligase (Thermo Fisher, 5 WU/µl) was added ...
-
bioRxiv - Microbiology 2021Quote: ... Cell monolayers were then stained with 3 mL of overlay containing a 1:1 mixture of 1.2% oxoid agar with 4% neutral red (Gibco) and 2X DMEM with 2% (vol/vol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... 5 mM DTT, 50 mM HEPES, 3 mM MgCl2, 2 mM PMSF, 1 Pierce™ protease inhibitor mini tablet/2 L; Thermo Scientific). The lysate was sonicated then incubated with 500 units/1 L culture Benzonase Nuclease (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... we changed the medium to a 1:1 mixture of KSR and N2B medium (DMEM F12, Thermo Fisher 11320033, with 1% GlutaMAX, 3% dextrose, N2-Supplement B, StemCell Technologies 07156, 5 μg/mL puromycin, Life Technologies A11138-03, and 2 μg/mL doxycycline). On day three ...
-
bioRxiv - Microbiology 2021Quote: ... Streptomyces hyphae were incubated with 0.5 mg/ml FM 4-64 Dye (N-(3-Triethylammoniumpropyl)24-(6-(4-(Diethylamino) Phenyl) Hexatrienyl) Pyridinium Dibromide) (Molecular Probes) for 15 min in the dark ...
-
bioRxiv - Neuroscience 2024Quote: ... 3% dilution, 4 µl,), Fluoro-ruby (FR, case BC, (10% solution, mixture of 10 kDA and 3 kDA, 4 µl; Invitrogen), and Biotinylated Dextran Amine (BDA ...
-
bioRxiv - Developmental Biology 2021Quote: ... These lines were routinely passaged every 3-4 days using Versene (ThermoFisher; 15040066). All lines were routinely screened for differentiation and tested for mycoplasma contamination.
-
bioRxiv - Biophysics 2022Quote: ... DiD (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine, 4-Chlorobenzenesulfonate salt) was purchased from ThermoFisher scientific (Molecular probes ...
-
bioRxiv - Neuroscience 2020Quote: ... Secondary antibody incubation was performed for 3-4 days and DiD (Thermo Fisher Scientific-Molecular Probes L7781 ...
-
bioRxiv - Neuroscience 2020Quote: ... 3-4 brains were dissected in chilled Schneider’s Drosophila medium (ThermoFisher Scientific, 21720001) in less than 5 minutes ...
-
bioRxiv - Plant Biology 2021Quote: ... that accumulates in hyperpolarized membranes and DiBAC(4)3 (Thermo Fisher Scientific, USA) that enters depolarized cells (Suchodolski and Krasowska ...
-
bioRxiv - Cell Biology 2021Quote: ... Bolt 4-12% Bis-Tris or NuPAGE 3-8% Tris-Acetate gels (Invitrogen) were used for electrophoresis ...
-
bioRxiv - Developmental Biology 2021Quote: ... and passaged every 3 – 4 days using Versene (Cat. # 15040066, Thermo Fisher Scientific). Culture dishes were pre-coated with 0.5% GelTrex matrix solution (Cat ...
-
bioRxiv - Neuroscience 2024Quote: ... Cells were split every 3-4 days when confluent using TrypLE Express (Gibco). For all immunoblotting and imaging experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (ThermoFisher) transferred to nitrocellulose membrane ...
-
bioRxiv - Neuroscience 2023Quote: ... 3/4 of the medium was replaced with Neurobasal medium (GIBCO, 21103-049) containing B27 and glutamax ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were passaged every 3-4 days using TrypLE Express (ThermoFisher, Cat# 12605036) and confirmed to be free of mycoplasma ...
-
bioRxiv - Neuroscience 2023Quote: ... After 3–4 days the colonies were dissociated using StemPro Accutase (Thermo Fisher), counted and plated at low confluency (10,000 cells/cm² ...
-
bioRxiv - Immunology 2024Quote: ... Cells were passaged every 3-4 days using 0.05% Trypsin-EDTA solution (Gibco).
-
bioRxiv - Cell Biology 2024Quote: ... Cells were loaded with 3 µM Fluo-4 AM (ThermoFisher Scientific cat# F14201) diluted in basal media for 30 minutes ...
-
bioRxiv - Bioengineering 2023Quote: ... The concentrated virus was diluted 1:5 in hepatocyte medium containing N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid buffer (HEPES; 20 mM; Gibco) and 4 μm/mL polybrene (Sigma ...
-
bioRxiv - Biophysics 2024Quote: ... were seeded in a 6-well culture plate at a concentration of 2 x 105 cells ml-1 (2 ml per well in DMEM (Nissui) supplemented with 5 % fetal bovine serum (Gibco), glutamine ...
-
bioRxiv - Neuroscience 2020Quote: ... Nuclei were stained with 4′,6′-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/ml, Molecular Probes). The sections were mounted using a fluorescence mounting medium (DAKO ...
-
bioRxiv - Genomics 2023Quote: ... The nuclear stain was 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng/mL; Molecular Probes). Sections were imaged digitally using a slide scanner (Olympus VS-120 Slide scanner ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were incubated with 4 μM fura-2 acetoxymethyl ester (fura-2/AM, Invitrogen, Cat# M1291) in HEPES-buffered solution (137 mM NaCl ...
-
bioRxiv - Immunology 2020Quote: ... 25mM HEPES (2(−4-(2-hydroxyethyl)-1-piperanzinyl) ethansulfonacid) and supplemented with 10% (v/v) fetal bovine serum (FBS; Gibco, ThermoFisher Scientific), 10.000 U/mL (v/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... were mixed in a 3:1 with sample buffer (NuPAGE™ LDS Sample Buffer (4X) + 2-Mercaptoethanol in 2:1) and loaded onto a precast Gel (NuPAGE™ 4-12% Bis-Tris Gel, Invitrogen). Proteins were transferred to nitrocellulose membranes ...
-
bioRxiv - Bioengineering 2024Quote: Coronal sections of healthy murine brain were prepared and stained as previously described101 either using 4’,6’-diamidino-2-phenylindole dihydrochloride (DAPI; 2 ng mL−1; Molecular Probes) to stain cell nuclei or primary antibodies for rabbit anti-NeuN (1:1000) ...
-
bioRxiv - Neuroscience 2021Quote: 5% biotinylated dextran-conjugated tetramethyl rhodamine 3000 MW (micro ruby, #D-7162; Molecular Probes, Eugene, OR) in distilled water47 ...
-
bioRxiv - Cell Biology 2024Quote: ... slides were washed in PBS 3×5 minutes and then stained with the secondary antibody Goat anti-rabbit AlexaFluor555 (Invitrogen #A21429, working concentration 2 µg/µl) or Goat anti-rat Alexa488 (Thermofisher #A-11006 ...
-
bioRxiv - Neuroscience 2021Quote: ... A silicon probe (Neuronexus A1×32-Poly2-5mm-50s-177-A32) covered in DiI solution (1,1’-dioctadecyl-3,3,3’,3’-tetramethyl indocarbocyanine; Invitrogen; UK) was implanted by lowering it slowly into the brain ...
-
bioRxiv - Cancer Biology 2024Quote: ... the tissues were stained with DAPI (4′,6-diamidino-2-phenylindole) for 5 minutes and mounted in ProLong™ Diamond Antifade Mountant (Thermo Fisher Scientific, MA, USA).
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Biochemistry 2024Quote: ... 5’-aagaattggagggaccaccccc-3’ (underline is the codon change T to R) and 5-tgtcacgcgctcaaagtggttg-3’ using the fusion DNA polymerase (Thermofisher). After treating the PCR products with DpnI (New England Biolabs ...
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Developmental Biology 2024Quote: ... and passaged every 3–5 days after approximately 5 minutes of incubation with 0.5 mM EDTA (15575020, Life Technologies).
-
bioRxiv - Neuroscience 2022Quote: ... cells were loaded in microglia differentiation medium with 3 μM Fluo-4 AM and 3 μM Fura-Red AM (Molecular Probes) in the presence of Pluronic Acid F-127 (Molecular Probes ...
-
bioRxiv - Cell Biology 2022Quote: ... Blocks of tissue of ~3×3×4 cm (depth×width×height) were cut and prepared for sectioning using a Vibrating Blade Microtome (Thermo Fisher) at a thickness of 500μm ...
-
bioRxiv - Bioengineering 2023Quote: Passage 3 and passage 4 cells from 8 donors (4 male and 4 female) were expanded in T175 flasks (Thermo Fisher Scientific, Hampton, New Hampshire USA) and were cultured until passage 5 (p3-5 and p4-5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% mercapto-2-ethanol and 1X Halt Protease Inhibitor Cocktail (Thermo Scientific; 1:200). Proteins were separated using SDS-PAGE ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by 2 weeks of selection with 3 μg mL−1 of puromycin (Thermo Fisher Scientific). Then ...