Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 10000+ citations for Dog Trefoil Factor 3 TFF3 Protein since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Cells were then fixed and permeabilized using the eBioscience Foxp3/Transcription Factor Staining Buffer Set (ThermoFisher). Cells were then stained using an antibody that recognized incorporated puromycin (Kerafast ...
-
bioRxiv - Neuroscience 2024Quote: ... non-integrating Sendai virus Yamanaka factors (CytoTune™-iPS 2.0 Sendai Reprogramming Kit; ThermoFisher Cat # A165167) per manufacturer’s recommendation ...
-
bioRxiv - Immunology 2024Quote: ... The cells were subsequently fixed with the Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed and permeabilized using the eBioScience™ FOXP3 Transcription Factor Staining Buffer Set (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Media was supplemented with either Macrophage colony-stimulating factor (M-CSF; 20 ng/ml, PMC2044; Invitrogen) or 20% L929 cell-derived conditioned media to differentiate bone marrow-derived monocytes into macrophages ...
-
bioRxiv - Neuroscience 2024Quote: ... the cells were fixed and permeabilized with eBioscience™ Foxp3 / Transcription Factor Staining Buffer (Invitrogen, USA) and were stained with following antibodies at RT for 40 min ...
-
bioRxiv - Immunology 2024Quote: ... surface-stained cells were fixed and permeabilized using eBioscience Foxp3/Transcription Factor Staining Buffer Set (Invitrogen) and stained with TF antibodies for 30 min at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... Samples were then fixed and permeabilized with either eBioscience Foxp3/Transcription Factor Staining Buffer Set (Invitrogen) or Fixation/Permeabilization Solution Kit (BD Biosciences) ...
-
bioRxiv - Immunology 2024Quote: ... Staining for Ki67 (SolA15) was performed using the Foxp3 / Transcription Factor Staining kit (Thermo Fisher Scientific) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... after fixation and permeabilization of cells using Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific), according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... Labeled cells were then fixed using eBioscience Foxp3 / Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... CD4+ T cells underwent intracellular staining using the Foxp3 / Transcription Factor Staining Buffer Set (eBioscience Thermofisher) with anti-FOXP3-PE (Biolegend) ...
-
bioRxiv - Immunology 2024Quote: ... Cells were washed and fixed with 1X eBioscience™ FoxP3/transcription factor fixation/permeabilization solution (Thermofisher) for 45 minutes at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... and containing recombinant human stem cell factor (h-SCF; Gibco, PeproTech, #300-07; 100 ng/mL) and human IL-6 (Gibco ...
-
bioRxiv - Physiology 2024Quote: ... HUVEC cells were cultured on Matrigel (Geltrex Reduced Growth Factor Basement Membrane Matrix, Invitrogen, Carlsbad, CA) coated 48 well plates with a seeding density of 42,000 cells/cm2 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Cells were cultured on Reduced Growth Factor Matrigel-coated plates in RB-media (RPMI media (ThermoFisher) supplemented with 1% B27 minus insulin (ThermoFisher) ...
-
bioRxiv - Immunology 2024Quote: ... cells were fixed and permeabilized using a transcription factor fixation and permeabilization buffer kit (Thermo Fisher), following the provided manufacturer protocol including a 30-minute fixation at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... cells were fixed and permeabilized with eBioscience Foxp3/Transcription Factor Staining Buffer Set (Thermo Fisher Scientific) and then incubated with heavy metal isotope-conjugated antibodies (Table S2) ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with mouse basic fibroblast growth factor (mbFGF, 20 ng/mL; Thermo Fisher, Cat. #PMG0034, Norway), mouse epidermal growth factor (mEGF ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Cell Biology 2023Quote: ... The bead-bound biotinylated proteins were analyzed by Western blotting using HRP-streptavidin diluted 1:40 000 in 3% BSA/TBST (Thermo Fisher Scientific, Rockford, IL, USA) and identified by mass spectrometry.
-
bioRxiv - Molecular Biology 2024Quote: ... Knockdown of the protein was monitored by western blotting against the V5×3 epitope using α-V5 mouse primary antibody (Invitrogen / Thermo Fisher Scientific – 1:1000). Oligonucleotides used for PCR amplification are given in Table S4.
-
bioRxiv - Systems Biology 2024Quote: ... Samples (3 μl corresponding to 600 ng of protein) were loaded on to the trapping column (Thermo Scientific, PepMap100, C18, 75 μm X 20 mm), using partial loop injection ...
-
bioRxiv - Physiology 2023Quote: ... Samples (3 μL corresponding to 600 ng of protein) were loaded on to the trapping column (Thermo Scientific, PepMap100, C18, 75 μm X 20 mm), using partial loop injection ...
-
bioRxiv - Genetics 2023Quote: Twenty μg protein samples were loaded into lanes of a 3-8% Tris-acetate gel (cat. EA0378BOX, NuPAGE™, Invitrogen, Thermo Fisher Scientific, CA, USA) and subjected to electrophoresis ...
-
bioRxiv - Genetics 2023Quote: Twenty μg protein samples were loaded into lanes of a 3-8% Tris-acetate gel (cat. EA0378BOX, NuPAGE™, Invitrogen, Thermo Fisher Scientific, CA, USA) and subjected to electrophoresis ...
-
bioRxiv - Genomics 2020Quote: ... and Protein A or Protein G Dynabeads (Invitrogen). After incubation ...
-
bioRxiv - Immunology 2022Quote: ... or with Dynabeads protein A/protein G (Thermofisher) combined with Abatacept ...
-
bioRxiv - Biochemistry 2021Quote: ... protein marker (NativeMark Unstained protein standard, LC0725, ThermoFisher) was diluted 50x in the working buffer (40 mM HEPES pH 7.5) ...
-
bioRxiv - Immunology 2020Quote: ... protein A and protein G magnetic beads (Invitrogen) were added to capture the antibody-chromatin complexes ...
-
bioRxiv - Immunology 2021Quote: ... For protein purification protein G dynabeads (Thermo Fisher), coupled with 2.5 µg of antibody (Table S8 ...
-
bioRxiv - Plant Biology 2022Quote: ... Magnetic Protein A and Protein G Dynabeads (Invitrogen) were added and incubated at 4 °C for 2 hours ...
-
bioRxiv - Neuroscience 2022Quote: ... Magentic dynabeads Protein G or Protein A (Invitrogen) were washed with 0.05% Triton X-100 in PBS ...
-
bioRxiv - Developmental Biology 2022Quote: ... Protein A and Protein G Dynabeads (Thermofisher Scientific) were washed twice with IP dilution buffer (150 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Plant Biology 2022Quote: ... Magnetic Protein A and Protein G Dynabeads (Invitrogen) were added and incubated at 4°C for two hours ...
-
bioRxiv - Cancer Biology 2024Quote: ... and Protein A or Protein G Dynabeads (Invitrogen) at 4 ℃ overnight ...
-
bioRxiv - Cancer Biology 2024Quote: ... Protein was precipitated using Protein G Dynabeads (Invitrogen), with rabbit anti-IgM IgG linker antibodies for the H2Aubi119 ChIP ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time PCR targeting PTPRZ1 (5’-ACTCTGAGAAGCAGAGGAG-3’ and 5’-CTGTTGTCTGTAGTATCCATTAG-3’) or GAPDH (5’-TCAAGGCTGAGAACGGGAAG-3’ and 5’-CGCCCCACTTGATTTTGGAG-3’) was performed with Power SYBR™ Green PCR Master Mix (Applied Biosystems 4367659) in three technical replicates.
-
bioRxiv - Microbiology 2023Quote: ... protein concentrations were determined by Bradford Protein Assay protein using Coomassie protein assay reagent (Thermo Fisher Scientific-Invitrogen, Waltham, MA, USA). 5 µg of each protein fraction was added to 1x loading buffer (250 mM Tris pH 6.8 ...
-
Direct analysis of ribosome targeting illuminates thousand-fold regulation of translation initiationbioRxiv - Molecular Biology 2020Quote: ... and 3′ biotinylated using the Pierce RNA 3′end biotinylation kit (Thermo Scientific 20160).
-
bioRxiv - Molecular Biology 2021Quote: ... counted and reseeded in 3 mL A medium (1:3 mix DMEM/F12 (Gibco) and Neurobasal (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...