Labshake search
Citations for Thermo Fisher :
1001 - 1050 of 10000+ citations for 7H Cyclopenta c pyridin 7 one 5 6 dihydro 3 methyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... MD) were cultured at 37 °C and 5% CO2 in DMEM (Gibco) supplemented with 10% fetal calf serum ...
-
bioRxiv - Immunology 2024Quote: ... and labelled with CellTrace Violet (5 μM, 20 min, 37 °C, Invitrogen). Labelled CD4+ T-cells were co-cultured (4 d ...
-
bioRxiv - Cell Biology 2023Quote: ... 85°C for 5 minutes (High Capacity cDNA Reverse Transcription Kit, ThermoFisher). Following conversion ...
-
bioRxiv - Genetics 2024Quote: ... MEFs were maintained at 37°C (5% CO2) in DMEM media (GIBCO) supplemented with 10% FBS ...
-
bioRxiv - Bioengineering 2024Quote: ... Cells were maintained (37 °C, 5% CO2) in Essential 8 media (Gibco) on 23 µg/cm2 Matrigel (Corning ...
-
bioRxiv - Genomics 2021Quote: ... One-step reverse transcription and real-time PCR was performed with a Quantstudio 5 (Thermo Fisher Scientific) using Power SYBR Green RNA-to-CT 1-Step Kit (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... Step one: wells were blocked for 1 hour in 80uL of 5% Blocker BLOTTO (ThermoFisher Scientific, #37530). Step two ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50,000 4T1 cells were injected and mice treated with either 1 or 3 doses of 8 mg/kg carboplatin or vehicle by tail vein injection staggered by one day with anti-VEGFR3 antibody (100 μg per injection × 3 total injections, I.P., eBioscience (now ThermoFisher), Control IgG ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified by real-time PCR with SYBR Green (DotScientific) using the one-step protocol QuantStudio 3 (ThermoFisher Scientific). Relative expression was calculated using the ΔΔCT method ...
-
bioRxiv - Microbiology 2021Quote: ... and quantified by real-time PCR with SYBR Green (DotScientific) using the one-step protocol QuantStudio 3 (ThermoFisher Scientific). Relative genomes were calculated using the ΔCT method ...
-
bioRxiv - Microbiology 2020Quote: ... one for virus quantitation (TCID50) and the other for vRNA extraction in TRIzol (ThermoFisher, 15596026; 1 in 3 dilution). Samples were stored at -80°C until required ...
-
bioRxiv - Immunology 2024Quote: ... One cm pieces of small intestine were then incubated in HBSS containing 3 mM EDTA and 7.5% FBS (ThermoFisher) for 1 hour in a shaker at 37° C ...
-
bioRxiv - Genomics 2023Quote: ... One microliter of each cDNA sample was used for TaqMan PCR (Eppendorf RealPlex Mastercycler and Applied Biosystems QuantStudio 3) with 50 heating cycles at 94°C for 30 seconds ...
-
bioRxiv - Cell Biology 2022Quote: MUTZ-3 cells (DSMZ) were cultured at 37°C in alpha-MEM (Life Technologies) supplemented with 20% FBS ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Biochemistry 2021Quote: ... cell pellets were incubated with 300 µL of 10 mg/mL lysozyme (prepared fresh in sterile H2O) and incubated for 7 minutes at 30°C/250 rpm to allow for efficient lysis by TRIzol reagent (Ambion). 10-15 glass beads (4mm diameter ...
-
bioRxiv - Neuroscience 2020Quote: ... Eyes were first incubated in 1 mL of high glucose Hanks balanced salt solution/0.5 mg/ml proteinase K (37°C, 7 min) and then in Neurobasal medium (Life Technologies) plus 10% fetal calf serum to stop enzymatic activity ...
-
bioRxiv - Microbiology 2020Quote: ... Bacterial cultures were grown at 37°C either in M9 media [M9 salts (248510, Difco)] supplemented with 0.4% glucose (6363-53-7, Fisher Scientific), 1 mM MgSO4 (Sigma Aldrich) ...
-
bioRxiv - Physiology 2020Quote: ... and incubated in cell* dishes at 37° C for 4 – 7 hours before adding cell culture medium (RPMI 1640, -glucose +glutamine, Gibco), supplemented with penstrep (10,000 U/ml penicillin / 10,000 μg/ml streptomycin ...
-
bioRxiv - Neuroscience 2024Quote: ... The reaction was cycled at 58°C annealing temperature along with a melt curve analysis using a QuantStudio 7 Flex (ThermoFisher). For the telomere primers ...
-
bioRxiv - Neuroscience 2024Quote: ... The reaction was cycled at 56°C annealing temperature along with a melt curve analysis using a QuantStudio 7 Flex (ThermoFisher). Each sample was run in duplicate ...
-
bioRxiv - Immunology 2024Quote: ... Each well was aspirated of residual cell culture media and incubated for 7 minutes at 37°C with 1 mL 1X TrypLE (Gibco) to detach the cells from the plate ...
-
bioRxiv - Immunology 2019Quote: ... 5’ ATCCGCACCGACTCGGT 3’ and Rv: 5’ GCGTAATACGACTCACTATAG 3’ and purified using the Quick gel extraction and PCR purification combo kit (00505495, ThermoFisher). The PCR products were confirmed by an agarose gel electrophoresis and by Sanger sequencing (Base Clear ...
-
bioRxiv - Zoology 2020Quote: ... This extended COI fragment was amplified using the dgLCO1490 (5’-GGT CAA CAA ATC ATA AAG AYA TYG G-3’) and COI-R1 (5’-TGT TGR GGG AAA AAR GTT AAA TT-3’) degenerate primers (synthesized by Invitrogen) from Meyer et al ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Cell Biology 2022Quote: ... 5’-AACGGGAAGCTTGTCATCAA-3’) (Berg et al., 2019) or telomeres (Telo, 5’-UUAGGGUUAGGGUUAGGGUU-3’) (McCaffrey et al., 2017) were transfected using RNAiMAX (Invitrogen). In brief ...
-
bioRxiv - Synthetic Biology 2024Quote: ... the full volume of media in each well was pipetted gently 4-5 times and added to 1 mL of FACS buffer containing 3 uM DAPI (PBS pH 7.4, 2–5 mM EDTA, 0.1% BSA, 3 uM DAPI (Thermo Scientific #62247)) ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were silanized in a 3:5:100 mixture of (3-Aminopropyl)triethoxysilane (APTES) (Fisher Scientific UK, Cat. No. 10677502), acetic acid ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5’-GGTTTGGGGCTGGGCAT-3’ and 5’-AGGTGCAGCAGCAGTACG-3’ primers (Guillen-Samander et al., 2022) and cloning with the TOPO TA Cloning Kit (Invitrogen).
-
bioRxiv - Microbiology 2024Quote: ... and Reverse primer: 3’-GGGCGGTAGTCGTAATTGTT-5’ were subjected to qRT-PCR for amplifying Amastin in QuantStudio 5 (Applied Biosystems) in triplicates ...
-
bioRxiv - Biochemistry 2022Quote: ... was mixed with 10 nm gold nanoparticles and was applied to the glow discharged surface and blotted at 4 °C and 100% relative humidity for 3 s and a blot force of −3 using the Vitrobot IV System (Thermo Fisher Scientific). Grids were plunged in 100% liquid ethane ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were blotted at 100% humidity for 3 s (13°C, 0 s drain time, blot force -3 to +2) with a Vitrobot Mark IV (Thermo Fisher Scientific) and plunged into liquid ethane ...
-
bioRxiv - Neuroscience 2023Quote: ... Neuron-cancer cocultures were quantified for neuronal outgrowth by identical image generation and processing with additional pre-incubation (3 drops/mL for 90 min at 37◦C) of NucRed Dead 647 ReadyProbes™ Reagent (TO-PRO-3 iodide) (Invitrogen, #R37113) for dead cells and NucBlue Live ReadyProbes™ Reagent (Hoechst 33342 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 5% (by volume) fluorescent bead solution (6 μm FocalCheck Microspheres; part no. F14807; ThermoFisher), prepared using deionized water ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-well well-plates were first coated with vitronectin (5 μg/mL, Thermo Fisher, USA) followed by a coating with 10% fetal bovine serum (ThermoFisher ...
-
bioRxiv - Microbiology 2022Quote: ... Single disks containing either 5 mg BA or 25 μg FLC (6 mm, Fisher Scientific) were placed in the center of the MH plates ...
-
bioRxiv - Cell Biology 2022Quote: ... Metabolically labeled NSPs were conjugated to tetramethylrhodamine 5-carboxamido-(6-azidohexanyl) (TAMRA-N3, Invitrogen, T10182) via CuAAC ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5 µl were directly loaded on a native polyacrylamide gel (6% DNA Retardation, Thermo Fisher) and run at 4 °C using 0.5 X TBE buffer for 60 min ...
-
bioRxiv - Microbiology 2021Quote: ... and 4 mg/l 5-(and-6)-carboxyfluorescein and succinimidyl ester (FITC; Thermo Fisher Scientific), respectively ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
A nepenthesin insert allosterically controls catalysis in the malaria parasite protease plasmepsin VbioRxiv - Microbiology 2022Quote: ... Lysates were then incubated for one hour at 4°C with Dynabeads-Protein A or Dynabeads-Protein G (ThermoFisher) that had been bound to anti-GFP (clone 3E6 ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were incubated at 37°C for one hour and then overlaid with 1.2% Avicel (FMC biopolymers) in Opti-MEM I (1X) + GlutaMAX (Gibco) for 72 hours ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... for one hour at 37°C and then purified using the MagJET NGS Cleanup Kit (Thermo Fisher Scientific, USA). 50 ng of the insert and 50 ng of the backbone (molar ratio of ∼1:10 ...
-
bioRxiv - Microbiology 2021Quote: ... This was incubated with periodic agitation for one hour at 37°C before being aspirated and replaced with 0.8% molten agar in DMEM/F-12 (Gibco) and 1.5 μg / mL TPCK trypsin ...
-
Drosophila immune priming to Enterococcus faecalis relies on immune tolerance rather than resistancebioRxiv - Immunology 2022Quote: ... Samples were centrifuged at 10,000 rcf at 4°C for one minute directly into a 1.5mL microcentrifuge tube containing 350uL TriZol (Life Technologies) (schematic in Supplementary Figure 4A) ...
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies overnight at 4°C and then incubated for an additional 3 hours at 4°C with 50 μL DynabeadsTM protein G (Life Technologies, 10004D). Following three washes with 1% Triton-TBS lysis buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by 40 cycles at 95° C for 3 s and 60° C for 20 s (7500 Fast Real-Time PCR System; Thermo Fisher Scientific). Taqman probes for Gnat1 (Mm01229120 ...
-
bioRxiv - Immunology 2023Quote: ... followed by 40 cycles at 95°C for 15 sec then 60°C for 1 min using a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Extracted MAC DNA was used as the quantification standard.
-
bioRxiv - Microbiology 2019Quote: ... ATPase was assayed by a continuous spectrophotometric method using a 2-amino-6-mercapto-7-methylpurine ribonucleoside/purine nucleoside phosphorylase reaction to detect the released inorganic phosphate (EnzChek Kit; Life Technologies, California, USA) (53) ...