Labshake search
Citations for Thermo Fisher :
951 - 1000 of 10000+ citations for rno mir 143 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... RT-PCR was performed with QuantStudio 5 (384 well format, Thermo Fisher) using FastStart Universal SYBR Green Master mix (Roche) ...
-
bioRxiv - Bioengineering 2021Quote: ... Quantitative RT-PCR was performed using SYBR Green (Applied Biosystems, Carlsbad, CA); the primers are listed in Supplementary Table 7 ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR were performed with TaqMan Gene Expression Assays (Applied Biosystems) on a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2020Quote: ... and used for RT-PCR amplification (Taq DNA Polymerase, Thermo Fisher Scientific). Amplification of 50 ng of cDNA was performed with the QuantiFast SYBR Green PCR Master Mix (Qiagen ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was done using SuperScript II reverse transcriptase (Thermo Fisher Scientific) and Expand high-fidelity PCR system (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2020Quote: ... SuperScript III One-Step RT-PCR System (Thermo Fisher Scientific, Darmstadt, Germany) was used to perform reverse transcription PCR (RT-PCR ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative RT-PCR was performed on an ABI7900HT detection system (Life Technologies) using Maxima SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Neuroscience 2022Quote: ... and RT-PCR using the ABI 7700 cycler (Applied Biosystems, California, USA). rAAVs titers were between 109 - 1010 genomic copies/μl.
-
bioRxiv - Cell Biology 2022Quote: ... RT-qPCR was performed in either 7500 Real-Time PCR (Applied Biosystems), QuantStudio™ 5 Real-Time PCR System (Applied bioscience ...
-
bioRxiv - Neuroscience 2021Quote: ... Quantitative RT-PCR was performed using PowerUpTM SYBRTM Green Master mix (ThermoFisher) and QuantStudioTM 3 Real-Time PCR System (Applied Biosystem) ...
-
bioRxiv - Neuroscience 2021Quote: ... SYBR-Green based quantitative real-time RT-PCR (ThermoFisher Scientific, Waltham, MA) was used for all the experiments.
-
bioRxiv - Microbiology 2021Quote: ... Reactions were run using Applied Biosystems 7500 fast RT-PCR machine (Thermofisher) as per manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific, catalog #: 11904018).
-
bioRxiv - Immunology 2022Quote: ... One-Step RT-PCR SuperScript™ III Platinum™ Kit (Life Technologies) was used for virus detection ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative RT-PCR was performed with SYBR Green (Applied Biosystems ® 7500) using GAPDH as endogenous control ...
-
bioRxiv - Physiology 2020Quote: ... q-RT-PCR was performed with a Mx3000 P system (Applied Biosystems) using SYBR® Premix Ex Taq™ II (TliRNaseH Plus ...
-
bioRxiv - Cancer Biology 2020Quote: ... RT-PCR was performed using a SYBR Green master mix (Applied Biosystems) and samples run in triplicate with custom-designed primers.
-
bioRxiv - Microbiology 2021Quote: ... Reverse transcription PCR was performed using SuperScript™ IV RT Mix (Invitrogen) and 2x Platinum™ SuperFi™ RT-PCR Master Mix (Invitrogen ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... RT-PCR measurements employed the AMV reverse transcriptase system (Applied Biosystems 4368814) and Q-PCR reactions (7900HT Fast Real-Time PCR ...
-
bioRxiv - Neuroscience 2019Quote: ... and quantified by real-time RT PCR using Taqman probes (Applied Biosystems) for MCT1 (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... using the SuperScript IV One-Step RT-PCR System (Thermo Fisher Scientific). Reactions were performed using a reverse transcription step at 50°C for 10 min ...
-
bioRxiv - Microbiology 2021Quote: ... Using a SuperScript III One-Step RT–PCR kit (Thermo Fisher Scientific), the RT-PCR product (596 bp ...
-
bioRxiv - Immunology 2020Quote: ... using SuperScript™ III Platinum One-Step Quantitative RT-PCR System (Invitrogen) and primers and probe (Eurofins ...
-
bioRxiv - Microbiology 2021Quote: ... and RNA converted to cDNA using the ThermoScript RT-PCR system (ThermoFisher). Expression of mctA ...
-
bioRxiv - Microbiology 2021Quote: ... using the RNA UltraSense one-step quantitative RT-PCR system protocol (Invitrogen).
-
bioRxiv - Immunology 2020Quote: ... Real-time RT-PCR assays were performed on StepOnePlus (Applied Biosystems, USA) using FastStart Universal SYBR Green Master (Rox ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription polymerase chain reaction (RT-PCR) (SuperScript IV enzyme (Thermo Scientific) followed by nested PCR (HotStarTaq Plus DNA Polymerase (Qiagen ...
-
bioRxiv - Molecular Biology 2021Quote: Quantitative RT-PCR was performed on a QuantStudio 3 System (Applied Biosystems) using the PowerUp SYBER Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2022Quote: ... RT-qPCR was performed using SYBR Green PCR Master Mix (Applied Biosystems). Primer sequences used for TMEMC8 were the following ...
-
bioRxiv - Cell Biology 2022Quote: ... All the qPCR and RT-PCR reagents were purchased from Thermo Scientific. Total RNA was reverse transcribed into cDNA by RT-PCR using High-Capacity cDNA Reverse Transcription Kit (Cat ...
-
bioRxiv - Cancer Biology 2022Quote: ... RT-PCR reaction was performed using custom TaqMan Array plates (ThermoFisher Scientific), pre-loaded with primers ...
-
bioRxiv - Physiology 2022Quote: ... on a QuantStudio 5 RT-PCR system (Applied Biosystems, Foster City, CA). Up to 48 libraries were sequenced per lane on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was performed using the SuperScript III Reverse Transcriptase kit (ThermoFisher) with oligo(dT)20 primer.
-
bioRxiv - Neuroscience 2022Quote: ... 2μg of cDNA prepared using a 2-step RT-PCR kit (Invitrogen) was used in 28 cycles of PCR with PlatinumTaq (Invitrogen ...
-
bioRxiv - Plant Biology 2022Quote: ... on a QuantStudio 5 RT-PCR system (Applied Biosystems, Foster City, CA). Up to forty-eight libraries were sequenced per lane on a HiSeq 4000 sequencer (Illumina ...
-
bioRxiv - Pathology 2023Quote: ... using SuperScript™ IV first-strand synthesis system for RT-PCR (Invitrogen) with random hexamers (50 ng/μL) ...
-
bioRxiv - Cell Biology 2022Quote: ... Conventional RT-PCR was performed by using AmpliTaq Gold® (Applied Biosystems) on C1000 Touch™ Thermal Cycler (Bio-Rad) ...
-
bioRxiv - Genetics 2023Quote: ... and quantitative RT-PCR performed using SuperScript II Reverse Transcriptase (Life Technologies) and then a Takyon SYBR Green PCR kit (Eurogentec ...
-
bioRxiv - Cell Biology 2023Quote: We used TaqMan One-Step RT-PCR Master Mix Reagents (Applied Biosystems) as described previously (19,24 ...
-
bioRxiv - Genetics 2023Quote: ... RT-qPCR was performed using a QuantStudio3 Real-Time PCR system (ThermoFisher). Reactions consisted of 5 μl PowerUpTM SYBRTM Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were assayed on a 7500 RT-PCR system (Thermo Fisher Scientific).
-
bioRxiv - Biochemistry 2023Quote: ... RT-PCR reactions were performed in a SimpliAmp Thermal Cycler (Applied Biosystems) following the cycling conditions described in Supplemental Table 1 ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-PCR was performed using platinum Taq DNA polymerase (Invitrogen, Carlsbad, CA) with human-specific primers for miR-214 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Quantitative RT–PCR was performed using iQ SybrGreen Supermix (4368708, Applied Biosystems) on the Bio-Rad CFX96 C1000 Touch Thermal Cycler and analyzed.
-
bioRxiv - Molecular Biology 2024Quote: ... RT-qPCR was performed using SYBR Green PCR master mix (Life Technologies). ACTB was used as the control for PCR product quantification and normalization ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA was generated by RT-PCR with SuperScript IV reverse transcriptase (ThermoFisher) and primer 5’ TGGCGTCAGACTTTGAGAAGC 3’ ...
-
bioRxiv - Systems Biology 2024Quote: ... and real-time RT-PCR performed with TaqMan MicroRNA assays (Life Technologies). All values are presented as the mean ± SEM of replicates in pooled experiments ...
-
bioRxiv - Developmental Biology 2024Quote: ... elegans RNA using SuperScript One-Step RT-PCR with Platinum Taq (Invitrogen). This PCR product was used as a transcription template to generate in vitro synthesized double stranded RNA using the MEGAscript RNAi Kit (Ambion) ...
-
bioRxiv - Immunology 2024Quote: ... RT-PCR was performed using the PowerUP SYBR Green Kit (Thermo Fisher) and the QuantStudio 5 Real-Time PCR Detection System (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2019Quote: ... qRT-PCR analysis was performed using gene-specific primers and SYBR Green PCR Master Mix (Applied Biosystems, 4309155). The sequences of the primers used are available upon request ...