Labshake search
Citations for Thermo Fisher :
951 - 1000 of 10000+ citations for IL 4 Mouse HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... and HEK293 cells were cultivated in Dulbecco’s Modified Eagle Medium (DMEM; TM4, HeLa: Gibco™ #41966 – high glucose ...
-
bioRxiv - Molecular Biology 2023Quote: ... the transiently transfected HEK293 cells were harvested using dissociation buffer TrypLE (Thermo Fisher Scientific) and binding assay buffer ...
-
bioRxiv - Bioengineering 2023Quote: The plasmid was transfected into HEK293 cells using Lipofectamine 3000 Reagent (Thermo Fisher Scientific) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: The human embryonic kidney HEK293 cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin solution at 37 °C under 5% CO2 ...
-
bioRxiv - Cell Biology 2022Quote: ... HEK293 cells were cultured in DMEM/F-12 cell culture medium (Gibco, Carlsbad, CA) supplemented with 10% FBS ...
-
bioRxiv - Immunology 2023Quote: ... FreeStyle™ HEK293-F cells were cultured in Freestyle™ 293 expression medium (Gibco).
-
bioRxiv - Biochemistry 2023Quote: HEK293 and C6 glioblastoma cells were cultured in Dulbecco’s Modified Eagle’s medium (DMEM; Gibco) supplemented with 10% heat-inactivated fetal calf serum (HI-FCS ...
-
bioRxiv - Neuroscience 2023Quote: ... The Flp-In T-REx HEK293 cell line was used (Thermo Fisher Scientific, R78007). Stably expressing cells were isolated by treating with 200 µg/mL hygromycin B (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: Reverse transfection was used to transiently transfect HEK293 cells using Lipofectamine 3000 (Thermo Fisher), using the method provided by the manufacturer ...
-
Analysis of RyR2 distribution in HEK293 cells and mouse cardiac myocytes using 3D MINFLUX microscopybioRxiv - Physiology 2023Quote: ... fixed HEK293 RyR2D4365-GFP cells were incubated with MA3-916 RyR2 monoclonal antibody (Invitrogen) diluted 1:100 at 4°C overnight in the same solution as above ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Flp-In HEK293 cells were cultured in high glucose pyruvate medium (Gibco, #10569010), supplemented with 10% FBS (Gibco ...
-
bioRxiv - Neuroscience 2024Quote: HEK293 cells and RAW264.7 macrophages were cultured in DMEM/F12 (cat:11320082, Thermo Fisher) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... Tetracycline-inducible cells (tetON cells) were made in HEK293 Flp-In TReX cells (Invitrogen) (gift from Nancy Maizels) ...
-
bioRxiv - Neuroscience 2024Quote: ... The experimental setup utilized an inducible T-REx HEK293 cell line (Thermo Fisher Scientific) expressing MC4-R and the inwardly rectifying K+ channel Kir7.1 mutant M125R ...
-
bioRxiv - Developmental Biology 2019Quote: ... overnight at 4°C and then goat anti-mouse Alexa488 (ThermoFisher Scientific, 1:200) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... Poly-L-ornithine was replaced with 4 μg/ml of mouse laminin (GIBCO #1094706) overnight at 37 °C ...
-
bioRxiv - Cell Biology 2019Quote: ... and Alexa Fluor®-594 goat anti-mouse IgG (Life Technologies, 4 μg/ml). Cells were washed and nuclei were stained with DAPI (600 nM) ...
-
bioRxiv - Immunology 2021Quote: ... 48h and labelled with 4 ng μL−1 mouse V5 specific primary antibody (Invitrogen) followed by 4 ng μL−1 goat-anti-mouse-AF488 (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... supernatants were immunoprecipitated at 4°C overnight with Dynabeads Sheep anti–Mouse IgG (Invitrogen) conjugated with an anti-FLAG antibody (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2024Quote: The liver median lobe from each mouse was fixed in 4% formaldehyde (Fisher Scientific) and embedded in paraffin for later histological analysis ...
-
bioRxiv - Bioengineering 2023Quote: ... the mouse brains were removed and submerged in 4% paraformaldehyde (Thermo Fisher, J19943.K2) overnight at 4 °C for fixation ...
-
bioRxiv - Microbiology 2023Quote: ... at 4 °C overnight followed by anti-mouse Alexa-594 (1:1000, Thermo Fisher) staining for 1 h at room temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... MSCs were stained with mouse anti-4-HNE (Invitrogen; 12F7; MA5-45792; 1:100) or with mouse anti-MDA (Invitrogen ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were washed once with 2% HI-FBS S-MEM and further stained with PE-conjugated anti-mouse IgM (Thermo Fisher Scientific, #12-5790-81) for 30 minutes to detect the HTII-280 primary antibody ...
-
bioRxiv - Microbiology 2024Quote: ... C-His-OipA protein was purified by using Dynabeads™ His-Tag Isolation and Pulldown magnetic bead system (Thermo Fisher Scientific, United States). His-tagged OipA protein isolation procedure was carried out according to kit instructions ...
-
bioRxiv - Immunology 2022Quote: ... either alone or with anti-IL-1β or anti-IL-6 neutralizing antibodies (Thermofisher, Waltham, MA), and ensuing protein lysates blotted for phosphorylated STAT-3 (pSTAT3) ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated overnight at 4 °C with ~100ul primary antibodies diluted in 1% BSA+Triton-X (Thermo Fisher Scientific, Rockford, IL, USA) [1] ...
-
bioRxiv - Immunology 2022Quote: ... The proteins were resolved by SDS-PAGE on 4-12% NuPAGE gels using NuPAGE MOPS buffer (NuPage gels, Thermo Fisher Scientific, Rockford, IL), and transferred to methanol-activated PVDF membrane (Perkin Elmer ...
-
bioRxiv - Immunology 2019Quote: ... Hemocytes nuclei were then stained by incubating with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL) (Thermo Fisher Scientific, Rockford, IL, USA) dissolved in PBS and washed thrice with PBS ...
-
bioRxiv - Immunology 2020Quote: Cells were plated and allowed to adhere to the cover glass of a 4-well or a 1-well chamber (Nalge Nunc International, Naperville, IL) precoated with Fibronectin (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2022Quote: ... spun in a microfuge at 13,000 rpm for 20 minutes at 4°C and supernatant protein concentration determined using the BCA (Thermo Fisher Scientific, Rockford, IL) or Bradford (Bio-Rad Laboratories ...
-
bioRxiv - Biochemistry 2024Quote: ... samples were clarified by centrifugation at 13.000 rpm for 15 min at 4 °C and protein concentration was determined using the BCA assay (Thermo Scientific, Rockford, IL, USA). Equal amounts of protein (40 – 50 μg ...
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), and forward and reverse primers (IDT ...
-
bioRxiv - Immunology 2021Quote: ... anti-IL-23p19-AF488 (fc23cpg, Invitrogen); anti-IL-1β-APC (NJTEN3 ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-6 (20 ng/mL, ThermoFisher). To generate human induced pluripotent stem cells (iPSCs) ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-3 (20 ng/mL, ThermoFisher), IL-6 (20 ng/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... 10 ng/ml IL-10 (Gibco), 2.5 μg/ml CpG oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTCGTT ...
-
bioRxiv - Cell Biology 2021Quote: ... caveolin-2 (Thermo Fisher, Rockford, IL), and STIM1/CRACR2A (CRAC regulator 2A ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylbenzidine (ThermoFisher Scientific, Rockford, IL, USA) and read at 450 nm according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: ... SyberGreen (Thermo Fisher, Rockford, IL, USA), forward and reverse primers (IDT ...
-
bioRxiv - Systems Biology 2022Quote: ... and IL-8 (Invitrogen, catalog # KHC0081) levels in the media samples were conducted according to the manufacturer’s protocol.
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... in duplicate by ThermoFisher (Life Technologies Corporation, Chicago, IL 60693) using Z’Lyte (76) ...
-
bioRxiv - Cell Biology 2022Quote: ... IL-8 (ThermoFisher Scientific, catalog # PHC0884), and ChaCha (Anaspec ...
-
bioRxiv - Neuroscience 2019Quote: ... IL-10 (ThermoFisher Scientific, Waltham, MA), and IL-1β (R&D Systems ...
-
bioRxiv - Immunology 2020Quote: ... and anti-IL-2 APC (Invitrogen) in permeabilization buffer for 30 min ...
-
bioRxiv - Physiology 2021Quote: ... TRIzol reagent (Thermo Scientific, Rockford, IL) was used to extract the total RNA from pepper and N ...
-
bioRxiv - Immunology 2021Quote: ... and Human IL-1β from ThermoFisher.
-
bioRxiv - Immunology 2022Quote: ... IL-6 (100 ng/ml, Invitrogen), TNF-α (10 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... IL-17A (Invitrogen, #88-7371-88), or IL-5 (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... and anti-IL-13-PECy7(Invitrogen 25-7133-82 ...