Labshake search
Citations for Thermo Fisher :
951 - 1000 of 10000+ citations for 7 Deaza 2' deoxyadenosine 5' O monophosphate 7 CH 5' dAMP dTuMP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... at 1,000g for 2 min and then immediately loaded into the QuantStudio 6 and 7 Flex real-time PCR system (ThermoFisher Scientific). A two-step cycling protocol was implemented to collect cycle threshold (Ct ...
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were washed and re-suspended in PBS buffer free of KCl and incubated in the dark with 25-μM of 2’,7’-dichlorodihydrofluorescein diacetate (CM-H2DCFDA) suspended in dimethylsulfoxide (DMSO) for 60 min at room temperature (Molecular Probes, Invitrogen). After incubation ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Library concentration was normalized to 2 nM and concentrations validated by qPCR on a ViiA-7 real-time thermocycler (Applied Biosystems), using qPCR primers recommended in Illumina’s qPCR protocol and Illumina’s PhiX control library used as a standard ...
-
bioRxiv - Immunology 2023Quote: ... Serum starved PANC-1 and MiaPaCa-2 cells were incubated with human properdin (20 µg/ml) and CellEvent™ Caspase-3/7 Green Detection Reagent (Invitrogen) (5 μM ...
-
bioRxiv - Physiology 2023Quote: ... cells were incubated with fresh DMEM containing DDAO galactoside (9H-(1,3-dichloro-9,9-dimethylacridin-2-one-7-yl) β-D-Galactopyranoside) (Molecular Probes™) for 2 hours ...
-
bioRxiv - Plant Biology 2024Quote: ... Ten-μg protein of each sample were separated by electrophoresis in 15% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride (PVDF) membranes (Roth) for 7 min at 20V using the iBlot 2 Dry Blotting System (ThermoFisher Scientific), before blocking in TBS-T with 5% (w/v ...
-
bioRxiv - Plant Biology 2024Quote: ... fluorescence was observed under a confocal microscope (LSM880NLO, Zeiss, Germany) using 2’,7’-dichlorodihydro fluorescein diacetate (H2DCFDA, 10 InvM, Invitrogen, USA) as described by Yu et al ...
-
bioRxiv - Microbiology 2024Quote: ... 7 μl per injection was loaded onto a 2 mm by 0.3 mm Acclaim PepMap C18 trap column (Thermo Fisher Scientific) in 0.1% TFA at 15 μl/min before the trap being switched to elute at 0.25 μl/min through a 50 cm by 75 μm EASY-Spray C18 column ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then dried at 100°C and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Cell Biology 2024Quote: ... The flow-through was then dried in a speed-vac and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Microbiology 2020Quote: PF 3D7 or C580Y lines were cultured and maintained at 1-5% parasitaemia in fresh group O-positive red blood cells re-suspended to a 5% haematocrit in custom reconstituted RPMI 1640 complete media (Thermo Scientific) containing 0.23% sodium bicarbonate ...
-
bioRxiv - Cancer Biology 2021Quote: ... Liver was perfused by pumping (4 ml/min for 5 min) a pre-warmed perfusion buffer (EBSS w/o CaCl2/MgCl2 with 0.5 mM EGTA, Gibco, Life Technologies) through a catheter inserted into the vena cava ...
-
bioRxiv - Microbiology 2022Quote: ... The lines were cultured and maintained at 1-5% parasitaemia in fresh group O-positive red blood cells re-suspended to a 5% haematocrit in custom reconstituted RPMI 1640 complete media (Thermo Scientific) containing 0.23% sodium bicarbonate ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Bioengineering 2024Quote: ... and 5 ng/ml of fibroblast growth factor-2 (FGF-2) (all from Gibco). Cells were seeded at a density of 3200 cells/cm2 until they reached 90% confluency ...
-
bioRxiv - Plant Biology 2019Quote: ... using a QuantStudio™ 7 Flex Real-Time PCR System (Applied Biosystems). The expression levels were calculated with the 2−ΔΔCt method ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 million primary neurons were plated on 60 mm culture dishes (ThermoFisher) and cultured for 7 days ...
-
bioRxiv - Cell Biology 2019Quote: MSFs were transfected with mRuby-Lifeact-7 using Lipofectamine 3000 (Life Technologies) 18 h after seeding into stretch chambers ...
-
bioRxiv - Cell Biology 2020Quote: ... [7] in the presence of 1X Halt protease inhibitor cocktail (Thermo Scientific) and protein quantified using the DC BioRad assay ...
-
bioRxiv - Cell Biology 2020Quote: ... The samples were run on the ViiA 7 thermocycler (Thermo Fisher Scientific) using standard cycling parameters provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2021Quote: ... and ran on a ViiA 7 Real-Time PCR System (ThermoFisher Scientific), with a 15-second 95°C denaturation step and a 1-minute 60°C annealing/extension step for 40 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... and 1 mM TCEP) with Zeba 7 kDa MWCO spin columns (ThermoFisher), re-quantified by A280 absorbance ...
-
bioRxiv - Developmental Biology 2021Quote: ... Plates were run on a ViiA-7 Real-Time PCR system (ThermoFisher), and CT values were auto-determined by the ViiA-7 software ...
-
bioRxiv - Immunology 2022Quote: ... on an ABI ViiA 7 Real-Time PCR system (Thermo Fisher Scientific). Forward and reverse primer sets were designed using NCBI Primer-Blast software and purchased from Integrated DNA Technologies ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Cell Biology 2022Quote: ... and differentiated into macrophages for 7 days in RPMI (Gibco, Life Technologies) supplemented with 5% fetal calf serum (FCS ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Immunology 2022Quote: ... and the ViiA 7 Real-Time PCR System (Applied Biosystems, ThermoFisher Scientific). Fam49b primers were forward ...
-
bioRxiv - Molecular Biology 2021Quote: ... The qPCR was run on Viia 7 RT-PCR system (Applied Biosystems). The fold-changes in gene expression were calculated by ΔΔCt method ...
-
bioRxiv - Immunology 2019Quote: PBMCs from 7 healthy donors were incubated with ATP (Invitrogen, 6.7 mM), adenosine (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... using the QuantStudio™ 7 Flex Real-Time PCR System (Life Technologies). ESRP1 was detected using (ESRP1 for AGCACTACAGAGGCACAAACA ...
-
bioRxiv - Immunology 2019Quote: ... CellEvent® Caspase-3/7 Green Detection Reagent (Thermal Fisher Scientific, C10423); CellTrace™ Violet (Thermo-Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: ... The reaction was carried out on a thermocycler (ViiA 7, Applied Biosystems) with the following program ...
-
bioRxiv - Cancer Biology 2021Quote: ... CellEvent™ Caspase-3/7 Green live staining detection reagent (Thermofisher Scientific) at 2 μM was prepared and added to the epithelial and vascular channels in order to visualize an apoptotic T-cell killing response ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Cell Biology 2021Quote: ... and a QuantStudio 7 Real-Time PCR system (Thermo Fisher Scientific, USA) (52) ...
-
bioRxiv - Microbiology 2021Quote: ... with 7 ml per plate in the following medium: RPMI-1640 (Gibco), 2 mM L-glutamine (LifeTechnologies) ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... Coverslips were carefully transferred to glass slides (Fisher Scientific, #12-544-7) and fixated using AquaPolymount (Polysciences Inc. ...
-
bioRxiv - Cancer Biology 2020Quote: ... Immunohistochemical staining was performed to confirm the presence of cytokeratin-7 (Thermofisher), pan-vimentin (DAKO) ...
-
bioRxiv - Cell Biology 2021Quote: ... qPCR was performed using ViiA 7 Real-Time PCR system (Applied Biosystems) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... EPCR PE (Clone RMEPCR1560, SCT) and 7-Aminoactinomycin D (7AAD) (Life Technologies). The cells were sorted on an Influx (BD ...
-
bioRxiv - Cell Biology 2020Quote: ... COS-7 cells were grown on thin coverslips (Thermo Fisher Sci. 12541A) in 6 well plates ...
-
bioRxiv - Bioengineering 2022Quote: ... qPCR reaction was run in ViiA 7 Real-Time PCR System (ThermoFisher) with standard program ...
-
bioRxiv - Molecular Biology 2022Quote: ... The measurement was performed in a qPCR instrument (Applied Biosystems ViiA 7) using a temperature ramp from 25–95 °C with a rate of 0.015 °C per second ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-caprin-1 (Invitrogen, PA5-96857; at a 7 : 10 000 dilution), anti-G3BP-1 (Millipore ...
-
bioRxiv - Immunology 2022Quote: ... on a Quant-Studio 7 Flex Real-Time PCR System (Applied Biosystems). Transcript abundances were normalized to 18S rRNA abundance ...
-
bioRxiv - Genomics 2022Quote: ... and HeLa S3 and MCF-7 RNAs were purchased from Thermo Fisher. RNAs from matched frozen healthy/tumor tissues of breast cancer patients were purchased from Origene (500 ng ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... which was run on a QuantStudio 7 Flex (Applied Biosystems, Thermo Scientific) machine with three-step amplification (1 ...
-
bioRxiv - Cell Biology 2022Quote: ... CellEvent Caspase 3/7 Green Detection Reagent was obtained from Thermo Fisher Scientific and used according to the manufacturer’s protocol.