Labshake search
Citations for Thermo Fisher :
751 - 800 of 10000+ citations for 7 Deaza 2' deoxyadenosine 5' O monophosphate 7 CH 5' dAMP dTuMP since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) (Thermo Fisher Scientific, A10044) was added to culture media at 10 µM final concentration for 1 hour ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 μl of 5 × Maxima RTA buffer (Thermo Scientific), which were mixed with Ultrapure water (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 5% FCS and 2% B-27 (Gibco) and maintained at 5% CO2 and 37°C in humidified incubators ...
-
bioRxiv - Neuroscience 2023Quote: EdU (5-ethynyl-2’-deoxyuridine; #A10044, Thermo Fisher Scientific) was diluted at 10mg/ml in 0.9% NaCl (#114-055-101 ...
-
bioRxiv - Biochemistry 2024Quote: ... 2 μg plasmid and 5 μl Lipofectamine 2000 (Invitrogen) were diluted into 200 μl Opti-MEM (Gibco ...
-
bioRxiv - Developmental Biology 2019Quote: ... The damp membrane was examined using an iBright FL1500 imaging system (Thermo Fisher Scientific) and the digital image caught directly by the instrument to authenticate that somite extract was loaded in every lane ...
-
bioRxiv - Cancer Biology 2022Quote: ... To count the apoptotic events cells were treated with a fluorescent dye detecting Casp3/7 activation (CellEvent™ Caspase-3/7 Green Detection Reagent, Thermo Fisher Scientific, Waltham, MA, USA).
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were incubated with 20-fold molar excess of either IANBD [N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol)ethylenediamine or Alexa Fluor 546 (AF546) maleimide (Molecular Probes] for 2 h at RT ...
-
bioRxiv - Biochemistry 2020Quote: ... The proteins were incubated with 20-fold molar excess of either IANBD [N,N ′ -dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol) ethylenediamine or Alexa Fluor 546 (AF546) maleimide (Molecular Probes] for 2 h at RT ...
-
bioRxiv - Microbiology 2020Quote: ... HEK 293T/17 (ATCC® CRL-11268) and LLCMK-2 (monkey kidney epithelial cells, ATTC CCL-7) were maintained in Tissue Culture Medium (DMEM (Invitrogen) supplemented with 10% Fetal Bovine Serum (Sigma) ...
-
bioRxiv - Cancer Biology 2022Quote: mScarlet-fascin/fascin KD or mScarlet/fascin KD HeLa cells were plated with 2 mM CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) in CellCarrier Ultra 384 well plates (PerkinElmer ...
-
bioRxiv - Zoology 2022Quote: ... 2.3 × 105 Huh-7 cells were transfected with 2 µg of pSpCas9-BB-2A-GFP-sgPURA using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 2 μL of 10 mM NBD-(linezolid-7-nitrobenz-2-oxa-1,3-diazol-4-yl)-amino-D-alanine (NADA) (Thermo Fisher) was added to each tube and incubated at 37° C ...
-
bioRxiv - Biophysics 2019Quote: ... N-((2-(iodoacetoxy)ethyl)-N-Methyl)- amino-7-Nitrobenz-2-Oxa-1,3-Diazole (IANBD ester) and Oregon Green 488 maleimide were purchased from LIFE TECHNOLOGIES LTD (Paisley ...
-
bioRxiv - Biophysics 2019Quote: ... N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)ethylenediamine] (Thermo Fisher Scientific, Inc., Waltham, MA). Y-ATRAM (Table 1 ...
-
bioRxiv - Biochemistry 2021Quote: ... with a 10-fold excess of N,N’-dimethyl-N-(iodoacetyl)-N’-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) ethylenediamine (IANBD-amide, Molecular Probes). After 90 min on ice ...
-
bioRxiv - Immunology 2021Quote: ... and then transferred to nitrocellulose membrane for 7 min at 20 V using the iBlot 2 Dry Blotting System (Invitrogen). Where protein phosphorylation status was investigated ...
-
bioRxiv - Neuroscience 2021Quote: Astrocytes at 3 DIV or at 7-8 DIV after lentivirus infection were loaded with 1 μg/ml Fura-2-AM (#F1221, ThermoFisher) in astrocyte culture medium for 30 min at 37 °C ...
-
bioRxiv - Neuroscience 2022Quote: Larval fish (4-7 dpf) were mounted in a small drop of 2% low melting point agarose (ThermoFisher Scientific 16520) in the center of the uncoated side of a mirror galvanometer (Thorlabs GVS0111) ...
-
bioRxiv - Cell Biology 2023Quote: The ROS dye assay was performed using Di(Acetoxymethyl Ester) (6-Carboxy-2’,7’-Dichlorodihydrofluorescein Diacetate) ROS dye (Invitrogen, D23844), a fluorogenic dye that is converted to 6-CarboxyFluorescein ...
-
bioRxiv - Microbiology 2023Quote: ... 7% of heat-inactivated fetal bovine serum (FBS) and 2% of G-418 disulfate 50mg/mL (all from ThermoFisher Scientific).
-
bioRxiv - Plant Biology 2023Quote: Quantification of ROS in guard cells of epidermal peels was measured using 20 µM 2’,7’-dichlorodifluorescein diacetate (H2DCFDA; Invitrogen) according to (30) ...
-
bioRxiv - Molecular Biology 2023Quote: The staining of oxidants was performed with the commercially available 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (#C6827, Thermo Fisher Scientific, USA). Cryo-sections (10 µm ...
-
bioRxiv - Bioengineering 2023Quote: A549 cells encapsulated in hydrogels were stained at the beginning (Day 7) and the end of culture (Day 28) with 2 µM Calcein-AM (Invitrogen) and 30 µg/mL propidium iodide (PI ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured for 7 days in Tu 2% media (1205Lu) supplemented with lipid depleted FBS (Omega Scientific, Fisher Scientific). Dox inducible LBR KD was initiated 3 days prior to the experiment ...
-
bioRxiv - Cancer Biology 2023Quote: ... organoids developed within 7 - 21 days after initial seeding and were first passaged (1:2) by dissociation using TrypLE Express Enzyme (ThermoFisher) and resuspension in OcellO primary organoid medium ...
-
bioRxiv - Bioengineering 2024Quote: COS-7 cells (ATCC, CRL-1651) and HeLa cells (ATCC, CCL-2) were cultured in high-glucose DMEM (Gibco, 21063029) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2024Quote: Reactive oxygen species (ROS) were quantitatively and qualitatively determined using the cell permeant 2’,7’-dichlorodihydrofluorescein diacetate (H2DCFDA) (ThermoFisher Scientific). H2DCFDA is a type of fluorescein that has been chemically reduced and is used to detect the generation of reactive oxygen intermediates in neutrophils and macrophages ...
-
bioRxiv - Plant Biology 2020Quote: ... Data acquisition and quantification was performed with Chromeleon 7 (Thermo Scientific).
-
bioRxiv - Biophysics 2021Quote: ... cells were harvested at day 7 using trypsin-EDTA (Fisher Scientific) and centrifugation (320g ...
-
bioRxiv - Cell Biology 2020Quote: ... on a QuantStudio 7 Flex real-time PCR detector (Thermo Fisher). Relative mRNA levels were normalized to those of GAPDH mRNA in each reaction and undetermined raw Ct values were set to 40 for analysis purposes ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... on a Viia 7 Real-Time PCR system (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... 7 µL of molecular grade water (Fisher Scientific UK Ltd, UK) and 2 μL of DNA template at the original sample concentration ...
-
bioRxiv - Molecular Biology 2020Quote: ... in a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems). All primers were used at 10 μM and sequences can be found in Table 1 ...
-
bioRxiv - Cell Biology 2022Quote: ... on the ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Each biological replicate was measured in technical duplicates ...
-
bioRxiv - Plant Biology 2019Quote: ... in a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific). Ct values for the gene of interest are expressed relative to that Ct value found for primers targeted to AT1G13320 ...
-
bioRxiv - Immunology 2019Quote: ... the CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) was added to the cells with complete media for 30 min in 37°C and the caspase-3/7 positive cells were measured on an Attune NXT flow cytometer (Life Technologies ...
-
bioRxiv - Immunology 2020Quote: ... and the ViiA 7 Real-time PCR system (Thermo Fisher Scientific). Primers used in this study are listed in Suppl ...
-
bioRxiv - Cancer Biology 2019Quote: ... CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen) was used according to the manufacturer’s protocol with modest modifications ...
-
bioRxiv - Biochemistry 2019Quote: ... The coding region for MCM3-7 were cloned into pFastbac (ThermoFisher). MCM3 was cloned with an N-terminal FLAG tag (DYKDDDDK ...
-
bioRxiv - Synthetic Biology 2019Quote: ... and 7 µl of 100X Halt protease inhibitor (Thermo Fisher Scientific). After 15 min of thawing and resuspension ...
-
bioRxiv - Physiology 2019Quote: ... QuantStudio 7 Flex Real time PCR system (Applied Biosystems Life Technologies)
-
bioRxiv - Physiology 2019Quote: ... QuantStudio 7 Flex Real time PCR system (Applied Biosystems Life Technologies)
-
bioRxiv - Bioengineering 2021Quote: ... in a ViiA 7 Real-Time PCR instrument (Thermo Fisher Scientific). The sequences of all used RT-qPCR primers are listed in Table 2 ...
-
bioRxiv - Immunology 2021Quote: ... on a ViiA™ 7 Instrument (Applied Biosystems, Thermo Fisher Scientific).
-
bioRxiv - Immunology 2021Quote: ... on a ViiA™ 7 Instrument (Applied Biosystems, Thermo Fisher Scientific).
-
bioRxiv - Microbiology 2021Quote: ... using a QuantStudio 7 Flex Real Time PCR System (Applied Biosystems). Primers are listed in Supplementary Table 1.
-
bioRxiv - Bioengineering 2020Quote: 293T and Huh-7 cells were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum (Gibco ...