Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Zika Virus NS1 Proteins Uganda Suriname Strains Duo Pack since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration of the purified virus preparations was determined using a BCA protein assay kit (Thermo Fisher Scientific) prior to the addition of lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding RSV NS1 was cloned by in vitro recombination (Gateway technology; Invitrogen) from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD) ...
-
bioRxiv - Biophysics 2023Quote: For protein expression and purification experiments we employed the commonly used protein expression strains BL21(DE3) (ThermoFisher Scientific) 20 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... We used strain YDL185W from the green fluorescent protein (GFP) clone collection (Invitrogen), which expresses Vma1p-GFP fusion protein [30] ...
-
bioRxiv - Molecular Biology 2022Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3)pLysS (Thermo Fisher Scientific). 1-4 liters of cells were grown in Luria-Bertani (LB ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins from virus-infected cells were immunoprecipitated using protein G magnetic Dynabeads according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Briefly ...
-
bioRxiv - Biochemistry 2020Quote: ... coli strain (ATCC 11303 strain, 14380, Affymetrix) were used.
-
bioRxiv - Cancer Biology 2019Quote: ... using the protocol adapted for tissue (KingFisher Duo machine, Thermo Fisher Scientific, Rockford, IL). RNA samples were then quantified (Qubit® 2.0 fluorometer ...
-
bioRxiv - Microbiology 2021Quote: ... using a KingFisher Duo Prime Purification System or a KingFisher Flex purification system (ThermoFisher), per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... with an automated nucleic acid extraction system (KingFisher Duo Prime; Thermo Fisher Scientific Inc.). We performed IPATS-BLV for DRB3*016:01 ...
-
bioRxiv - Microbiology 2023Quote: ... The samples were run on a Vanquish Duo UHPLC binary system (Thermo Fisher Scientific) coupled to IDX-Orbitrap Mass Spectrometer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2023Quote: ... for subsequent rounds a Kingfisher Duo Prime magnetic bead purification system was used (Thermofisher). The X15 library was depleted for bead-binding phage by incubation with Dynabeads (Thermofisher ...
-
bioRxiv - Plant Biology 2023Quote: ... DNA was extracted from lyophilized leaf or tuber tissue with KingFisher Duo (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... The samples were desalted on Sep-Pack C18 columns (Thermo Scientific), completely dried using speed vac centrifugation ...
-
bioRxiv - Cell Biology 2022Quote: ... Lysates were diluted to equal volumes and 30 ug protein was loaded per well using the Novex WedgeWell Tris-Glycine Welcome Pack (ThermoFisher Scientific, cat #XP0420B). The SDS-PAGE gel was transferred to a nitrocellulose membrane (Sigma ...
-
bioRxiv - Immunology 2019Quote: ... Unlabeled Staphylococcus aureus (Wood strain without protein A) BioParticles were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: For protein purification Escherichia coli strains were tested for optimal expression: BL21 DE3 (Thermofisher) was selected for PpMurE_L63_pPROEX and BL21(DE3) ...
-
bioRxiv - Microbiology 2019Quote: ... Strains used for cloning and expression of recombinant proteins were Escherichia coli TOP10 (Invitrogen) and E ...
-
bioRxiv - Plant Biology 2022Quote: ... The Fe content was analysed using ICP-OES (iCAP 6300 Duo ICP-OES, Thermo Scientific).
-
bioRxiv - Biochemistry 2022Quote: ... Inductively coupled plasma mass spectrometry (ICPMS, ICAP 7200 Duo + ASX-560, Thermo Fisher Scientific, USA) was used to determine the concentration of MNPs in MGVs ...
-
bioRxiv - Immunology 2023Quote: ... Media containing virus particles was first concentrated to 20x using 100K MWCO protein concentrator columns (Thermofisher). Concentrated virus was then incubated using 1:2000 DiD-Cell labelling solution (ThermoFisher V22887 ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-NS1 antibody binding was detected by a biotinylated goat anti-mouse IgG secondary antibody solution (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2022Quote: ... Kidneys were placed in pre-weighed whirl-pack bags (Thermo Fisher Scientific) containing 1ml of water ...
-
bioRxiv - Microbiology 2020Quote: ... and pHrodo™ AM Variety Pack (P35380) were purchased from Thermo Fisher. Itraconazole and camostat were purchased from Selleck Chemicals ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and a differential stain was performed (Hema 3 Stat Pack, ThermoFisher Scientific) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... coli strains DH5α and DH10B strains (both from Invitrogen) were used for molecular cloning ...
-
bioRxiv - Microbiology 2021Quote: ... Porcine reproductive and respiratory syndrome virus [PRRSV] European and North American strains (LSI VetMAX™ PRRSV EU/NA Real-Time PCR Kit; Thermo Fisher Scientific, MA, USA), Swine influenza virus [SIV] (EXOone Influenza A ...
-
bioRxiv - Microbiology 2021Quote: Vero81 cells were adsorbed with CHIKV strains diluted in virus dilution buffer (VDB, RPMI medium with 25 mM HEPES [Gibco] supplemented to contain 1% FBS) at a multiplicity of infection of 0.01 plaque-forming units (PFU)/cell at 37°C for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... Strains with GFP-labeled endogenous proteins were from the yeast GFP clone collection (ThermoFisher Scientific) (52) ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the standard “cell and tissue DNA” kit on a KingFisher Duo Prime purifier (ThermoFisher Scientific), with added RNAse A to avoid RNA contamination ...
-
bioRxiv - Microbiology 2023Quote: ... and DNA was extracted using the Kingfisher Duo Prime MagMax microbiome kit (Thermo Scientific, Waltham, MA). DNA was sequenced by Genome Quebec using both Illumina MiSeq and PacBio Sequel II technologies ...
-
bioRxiv - Immunology 2024Quote: ... Viral RNA extraction was performed using a KingFisher Duo Prime Purification System (Thermo Fisher Scientific, MA). In brief ...
-
bioRxiv - Molecular Biology 2020Quote: ... coli strain (Thermofisher), and purified using a Plasmid DNA Gigaprep kit (Zymo) ...
-
bioRxiv - Biochemistry 2024Quote: ... coli strain (ThermoFisher), blue-white colony screen was performed ...
-
bioRxiv - Microbiology 2024Quote: ... coli strain (Invitrogen) was used for cloning and routinely grown at 37°C (30°C for protein production ...
-
bioRxiv - Cancer Biology 2020Quote: ... cells were stained with the Hema 3 stat pack (Fisher Scientific #23-123869) and images captured with a Nikon Eclipse E200 microscope equipped with an Infinity 2 color camera (Lumenera ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and differential staining was performed with a Hema 3 Stat Pack (Thermofisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Its genomic DNA was extracted using the KingFisher™ Duo Prime Magnetic Particle Processor (ThermoFisher Scientific, USA) and the KingFisher Cell and Tissue DNA Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Systems Biology 2023Quote: ... according to the manufacturer’s high-throughput protocol using the KingFisher Duo Prime Purification System (Thermo Fisher Scientific). RNA was eluted in 50 μl of MagMAX Elution Buffer ...
-
bioRxiv - Microbiology 2023Quote: ... and the iron quantification was performed on an ICP-OES iCAP 6300 Duo MFC (Thermo Fisher Scientific) at Humboldt University Berlin.
-
bioRxiv - Developmental Biology 2022Quote: Mouse zygotes (C57BL6/N strain) were injected with 200 ng/µL Cas9 protein (IDT and ThermoFisher), 100 ng/µL Fzd2-specific sgRNA (GCAAGACACTGCACTCGTGG) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Mouse zygotes (C57BL/6N strain) were injected with 200 ng/μl CAS9 protein (IDT and ThermoFisher), 100 ng/μl Tgfbr2-specific sgRNA (AGGTCAAGTCGTTCTTCACT) ...
-
bioRxiv - Cell Biology 2023Quote: ... BacMam 2.0 virus (Invitrogen, C10593).
-
bioRxiv - Microbiology 2019Quote: ... The purified virus was quantified using the bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... Loss of virus was monitored by staining with anti-Sendai virus antibody (Invitrogen, cat #14649482).
-
bioRxiv - Immunology 2020Quote: ... and stained with Diff-Quik (Siemens) or Hema 3™ Stat Pack (Fisher Scientific) stain sets for differential counting ...
-
bioRxiv - Bioengineering 2022Quote: ... [2-(N-morpholino)ethanesulfonic acid] (MES) buffered saline pack was purchased from Thermo Scientific. Chemicals sensitive to moisture ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 750ng plasmid and 750ng pack mix were mixed in 200uL serum-free OptiMEM (Gibco) along with 2-8uL PEI ...
-
bioRxiv - Cancer Biology 2023Quote: ... Transwell inserts were stained using Hema 3 Stat Pack (Thermo Fisher Scientific #123-869). Migration inserts were randomized prior to manual quantification and the outer 5% of the inserts were not included during quantification to reduce edge-effect bias ...
-
bioRxiv - Synthetic Biology 2021Quote: All yeast strains were derived from parental strains Fy251 [American Type Culture Collection (ATCC) 96098] or the two-hybrid strain MaV20330 (Invitrogen). Yeast transformations were carried out using the lithium acetate method48 ...