Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Saint Louis Encephalitis Virus NS1 Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Microbiology 2021Quote: ... Equal amounts of the cell lysate protein and equal volume of the virus pellet protein were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris gel; Invitrogen/Thermo Scientific) and transferred onto nitrocellulose membrane by semidry transfer ...
-
bioRxiv - Biochemistry 2022Quote: ... The resulting gel was stained with SybrSafe (Thermofisher Scientific, Saint-Laurant, QC) and visualized.
-
bioRxiv - Biochemistry 2022Quote: ... followed by staining with Sybr safe (Thermofisher Scientific, Saint-Laurant, QC, Canada) and visualization ...
-
bioRxiv - Bioengineering 2023Quote: ... objects were washed with 70% EtOH (Fisher Scientific, Saint-Laurent, Quebec, Canada) several times and dried under a stream of pressurized nitrogen gas ...
-
bioRxiv - Bioengineering 2023Quote: ... closed channels were rinsed with isopropanol (Fisher Scientific, Saint-Laurent, Quebec, Canada), and dried under a stream of pressurized nitrogen gas.
-
bioRxiv - Microbiology 2020Quote: ... or P1 SARS-CoV-2/München- 1.1/2020/929 (Munich) virus was diluted to 500 µl in 15 ml with virus dilution medium (Opti-MEM, Gibco) supplemented with 2% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Next day cells were washed with phosphate-buffered saline (PBS) and infected with virus in Virus Production Serum Free Media (VPSFM; Gibco) supplemented with 0.25-0.5 ug/mL TPCK-Trypsin ...
-
bioRxiv - Immunology 2019Quote: ... and Moloney Murine Leukemia Virus reverse transcriptase (Invitrogen). Amplification of cDNAs was performed by quantitative real-time PCR reactions on a Light Cycler instrument (LC480 ...
-
bioRxiv - Microbiology 2020Quote: ... Virus was diluted in infection media (DMEM (Invitrogen) supplemented with 35% BSA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... using Sendai virus-mediated transduction (Thermofisher Scientific, #A16517) or nucleofection (Amaxa ...
-
bioRxiv - Microbiology 2020Quote: ... and 50% virus solution in RPMI media (Gibco). Mosquitoes were left to feed for 1.5 h using Hemotek membrane feeder system (Discovery Workshops ...
-
bioRxiv - Immunology 2021Quote: ... virus was diluted in RPMI-1640 media (Gibco) and maintained on ice ...
-
bioRxiv - Neuroscience 2022Quote: ... virus was mixed with 4% fast green (Invitrogen) dissolved in saline and injected using a glass micropipette at a rate of 100 nl/min ...
-
bioRxiv - Cancer Biology 2023Quote: ... then virus pellets were suspended in HBSS (Gibco). The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara) ...
-
bioRxiv - Genomics 2023Quote: ... infected with the Cytotune Sendai virus (Life Technologies) per manufacturer’s protocol to initiate reprogramming ...
-
bioRxiv - Genetics 2024Quote: ... using Sendai virus-mediated transduction (Thermofisher Scientific, #A16517) or nucleofection (Amaxa ...
-
bioRxiv - Neuroscience 2023Quote: ... Virus particles were resuspended in Neurobasal A (Invitrogen) and stored at -80 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by staining with Sybr™ Safe (Thermofisher Scientific, Saint-Laurant, QC, Canada) and visualisation ...
-
bioRxiv - Cell Biology 2023Quote: ... Explants were suspended in 90% foetal bovine serum (Gibco Invitrogen Saint Aubin, France)/ 10% dimethyl sulfoxide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2023Quote: ... Explants were suspended in 90% foetal bovine serum (Gibco Invitrogen Saint Aubin, France)/ 10% dimethyl sulfoxide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... media was collected from each well at 24 h and virus RNA was isolated using MagMAX Virus/Pathogen II Nucleic Acid Isolation Kit (Thermo Fisher Scientific) and automated extraction was carried out using KingFisher™ Flex Purification System ...
-
bioRxiv - Molecular Biology 2022Quote: ... Phasi Charoen like virus and Culex Y virus) were maintained at 28 °C in Leibovitz’s L-15 medium (Invitrogen: catalogue number: 21083027) supplemented with 10% foetal bovine serum (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: Genomic RNAs of PRRSV (porcine reproductive and respiratory syndrome virus) and CSFV (classic swine fever virus) were extracted following the TRIzol method (TRIzol reagent, Invitrogen, California, USA). Extracted RNA of PRRSV was examined using VDx PRRSv qRT-PCR (NA/EU dual ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acid was detected by virus-specific primer/probe according to indicated reference sequences (Table 1) utilizing TaqMan™ Fast Virus 1-Step Master Mix (Applied Biosystems) and QuantStudio™ 5 (ThermoScientific ...
-
Evolutionary stasis of an RNA virus indicates arbovirus re-emergence triggered by accidental releasebioRxiv - Evolutionary Biology 2019Quote: ... and virus isolates using Trizol LS® (Invitrogen, USA) and purified using Direct-zol RNA MiniPrep (Zymo Research ...
-
bioRxiv - Cell Biology 2022Quote: ... or Sendai virus system Cytotune 2.0 (Thermo Scientific #A16517). Resulting iPSCs were clonally picked and expanded in mTESR (Stemcell Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... The virus inoculum was prepared in OPTI-MEM (Gibco), and cells were incubated in SMEM at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... Pelleted virus was resuspended in PBS and TRIzol (Invitrogen) extracted ...
-
bioRxiv - Microbiology 2022Quote: ... and from virus in supernatant using Trizol LS (ThermoFisher). A one-step qRT-PCR kit with SYBR green from Agilent was used ...
-
bioRxiv - Microbiology 2021Quote: ... virus stocks were diluted in OptiPRO SFM (ThermoFisher Scientific) serum-free medium according to the desired MOI ...
-
bioRxiv - Microbiology 2020Quote: ... The virus pellet was washed in HBSS (Thermo Fisher), and centrifuged at 100,000 × g (Beckman SW 32 Ti rotor ...
-
bioRxiv - Immunology 2022Quote: ... and Moloney murine leukemia virus (MMLV) reverse transcriptase (Invitrogen), followed by RT-PCR with Fast SYBR Green PCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... Immobilised virus was fixed with 4% formaldehyde (Thermo Scientific) in phosphate buffered saline (PBS ...
-
bioRxiv - Microbiology 2020Quote: Virus stocks were prepared by transfecting 293FT cells (Invitrogen) seeded in 10 cm cell culture dishes with the viral constructs described above ...
-
bioRxiv - Microbiology 2023Quote: ... TaqMan Fast Virus 1-step Master Mix (Applied Biosystems) and primer/probes targeting NS3 primers/probe (IDT)11 ...
-
bioRxiv - Microbiology 2024Quote: ... and TaqMan Fast Virus 1-Step Master Mix (ThermoFisher). Reactions were set up according to the manufacturer’s protocols using a 10 µl reaction volume and 25 ng of total RNA template ...
-
bioRxiv - Cancer Biology 2024Quote: ... virus was prepared in high-glucose DMEM (Gibco, #11965092) supplemented with 10% FBS and 1% penicillin–streptomycin ...
-
bioRxiv - Microbiology 2021Quote: ... MHV-A59 was quantified by RT-qPCR by amplifying a fraction of its ORF5 gene for the structural protein M.15,16 The TaqMan™ Fast Virus 1-Step Master Mix Kit (Thermo Fisher Scientific Inc., 4444432) was used for RT-qPCR ...
-
bioRxiv - Immunology 2021Quote: The RBDwt protein was conjugated to Cucumber mosaic virus - tetanus toxoid (CuMVTT) using the linker Succinimidyl 6-(beta-maleimidopropionamido) hexanoate (SMPH) (Thermo Fisher Scientific, Waltham, USA). CuMVTT contains a powerful T cell epitope of the Tetanus toxin (TT ...
-
bioRxiv - Immunology 2023Quote: ... and H1N1/2009 influenza virus strains were prepared by overnight incubation of the virus strains with 0.1% v/v β propiolactone (Acros Organics, Geel, Belgium) under continuous rotation at 4°C ...
-
bioRxiv - Systems Biology 2019Quote: ... supplemented with 10% (v/v) fetal bovine serum (FBS; Life Technologies, Saint-Aubin, France), 1% L-glutamine (2 mM ...
-
Measuring adaptation dynamics to hydrogen peroxide in single human cells using fluorescent reportersbioRxiv - Cell Biology 2020Quote: ... supplemented with 10% (v/v) fetal bovine serum (FBS; Life Technologies, Saint-Aubin, France), 1% L-glutamine (2 mM ...
-
bioRxiv - Biophysics 2020Quote: ... Samples were prepared in nuclease-free water (Ambion, Life technologies SAS, Saint-Aubin, France). Data analysis was performed with OriginPro 2018 (OriginLab ...
-
bioRxiv - Bioengineering 2023Quote: ... The samples were then washed in 70% EtOH (Fisher Scientific, Saint-Laurent, Quebec, Canada) for 48 h before the compression test ...
-
bioRxiv - Biophysics 2023Quote: ... and dissolved in either nuclease-free water (Ambion, Life technologies SAS, Saint-Aubin, France) or D2O at a target concentration of 1 mM ...
-
bioRxiv - Microbiology 2019Quote: ... with TaqMan fast virus 1-step master mix (Thermo scientific) using AriaMx instrumentation (Agilent).
-
bioRxiv - Cancer Biology 2019Quote: ... Virus was then resuspended in 1:1 Opti-MEM (Gibco) - HBSS ...
-
bioRxiv - Microbiology 2019Quote: ... fibroblast-derived virus stocks were treated with TurboDNase (Thermo Fisher). For this ...