Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 8 2 5 dimethyl 4 chlorophenylsulfonamido 1 naphthol 3 6 disulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Neuroscience 2023Quote: ... with 4′,6-diamidino-2-phenylindole (DAPI; ThermoFisher, 1:5000) were applied in blocking solution for 1h at RT on an orbital shaker ...
-
bioRxiv - Cell Biology 2024Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride, 1:10,000, Invitrogen) was used as a DNA counterstain together with the secondary antibody ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... Samples were drawn after 0.5, 1, 3, 5, 8, and 24 h incubation and centrifuged (21500 xg, 4 °C, 20 min) (Thermo Scientific SL 8R Centrifuge ...
-
bioRxiv - Microbiology 2019Quote: ... Coverslips were stained with 300 nM 4’,6-diamidino-2-phenylindole nucleic acid stain (DAPI; Invitrogen) in PBS for 5 min followed by washing three times in PBS at room temperature ...
-
bioRxiv - Immunology 2020Quote: ... 25 mM 4-(2-hydroxyethyl)-1-piperazineeethanesulfonci acid (HEPES; Thermo Fisher), and 1X non-essential amino acids (Gibco ...
-
bioRxiv - Genomics 2023Quote: ... 1X 4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid (HEPES) (Thermo Fisher Scientific), 1X MEM non- essential amino acids (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Nuclei were stained with 5 µg / µl 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen) and slides were mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Pathology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies, 1:250) to reveal actin and the nucleus ...
-
bioRxiv - Physiology 2020Quote: ... and subsequently 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:50000) for 20 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, 1:50000 dilution, Molecular Probes) was treated in the cells for 3min ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen, #D1306, 1/1000) were incubated overnight at 4°C in the dark ...
-
bioRxiv - Microbiology 2024Quote: ... 4’,6’-diamino-2-fenil-indol (DAPI) (1:25000, Life Technologies) and Phalloidin (Alexa 488 ...
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Molecular Biology 2021Quote: ... 10 mM of 4-(2-hydroxyethyl)-1-piperazine-1-ethanesulfonic acid (HEPES) (Gibco) and 1 ng/mL of human bFGF (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) buffer (1 M) (Invitrogen, cat.#15630080), CellMask membrane dye (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Biochemistry 2020Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes).
-
bioRxiv - Cell Biology 2022Quote: ... 1.2M sorbitol buffer (pH 7.5) and permeabilized with 1% Triton X-100 stained with 1 μg/ml DAPI (4’, 6-diamidino-2-phenylindole; Molecular Probes). Cells were imaged using a DeltaVision Ultra microscope with a 60X objective (NA = 1.42) ...
-
bioRxiv - Neuroscience 2022Quote: ... 1:2000) and 4′,6-diamidino-2-phenylindole (DAPI, 1:1,000, Life Technologies). Following several washes ...
-
bioRxiv - Neuroscience 2022Quote: ... IL-6 (1:4-1:2 dilution, #KMC0061; ThermoFisher Scientific, Waltham, MA, USA), and NfL (1:4 dilution ...
-
bioRxiv - Biochemistry 2023Quote: ... coverslips were stained for 5 min with 1 μg/ml 300 nM 4′,6-diamidino-2-phenylindole (Life Technologies) to visualize nuclei ...
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Neuroscience 2019Quote: ... post-axotomy cultures were loaded with lipophilic dye N-(3-trimethylammoniumpropyl) -4-(6-(4-(diethylamino) phenyl) hexatrienyl)pyridinium dibromide (FM 5–95; Invitrogen) using KCl mediated depolarization as described previously (Taylor et al ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Microbiology 2019Quote: ... and 25 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES; Thermo Fisher), referred to as complete DMEM (cDMEM) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 24 mL 5% NaHCO3 (Gibco ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) were purchased from Gibco/Thermo Fisher Scientific (Grand Island ...
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2021Quote: ... at 1:200 and (4’,6-diamidino-2-phenylindole) DAPI (Fisher Scientific) at 1:10,000.
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Invitrogen, Thermo Fisher Scientific) was added to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... and 4’,6’-diamidino-2-phenylindole dihydrochloride (1 µg/ml, Life Technologies) for 2 hr ...
-
bioRxiv - Cell Biology 2022Quote: ... DAPI was used (4’,6-Diamidino-2-Phenylindole, Dihydrochloride, 1:10,000, Invitrogen). For staining of lipid droplets ...
-
bioRxiv - Neuroscience 2019Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI – D1306, Life Technologies, 1:50000) fluorescent secondary antibodies were used in all immunocytochemistry experiments where applicable ...
-
bioRxiv - Physiology 2020Quote: ... and DAPI (4’,6-diamidino-2-phenylindole, 1 μg ml1; ThermoFisher, #D1306) overnight at 4°C ...