Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 8 2 5 dimethyl 4 chlorophenylsulfonamido 1 naphthol 3 6 disulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2019Quote: ... 2’-disulfonic acid (20 mM) (AMS) (Invitrogen) in the dark ...
-
bioRxiv - Cell Biology 2021Quote: ... and the pellets were dissolved in 0.1% SDS/ 0.67 M Tris-HCl pH 8 +/- 15 mM 4-acetamido-4’-maleimidylstilbene-2,2’-disulfonic acid (Thermo Fisher Scientific, USA). The samples were incubated at 37 °C for 2 h ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Physiology 2019Quote: ... Cardiac perfusion with DiIC18(5)-DS (1,1’-Dioctadecyl-3,3,3’,3’-Tetramethylindodicarbocyanine-5,5’-Disulfonic Acid; Thermo Fisher Scientific) diluted in 4% paraformaldehyde (PFA ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2022Quote: ... while 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindodicarbocyanine-5,5′-disulfonic acid (DilC18) was purchased from Invitrogen. All stock solutions were prepared in chloroform/methanol (2:1 ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... external cysteine residues were blocked with 107 μM 4-acetamino-4’-maleimidylstilbene-2,2’-disulfonic acid (AMS, Thermo Scientific) for 20 min on ice ...
-
bioRxiv - Microbiology 2021Quote: ... lysates were spun at 10,000 x g for 10 minutes at 4 °C prior to reaction with 4- acetamido-4’-maleimidyl-stilbene-2,2’-disulfonic acid (AMS) (ThermoFisher Scientific). AMS alkylation was performed by vortexing the lysates in 15 mM AMS ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Immunology 2023Quote: ... at least 50 000 cells were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Immunology 2021Quote: ... Uptake of fatty acids was quantified after incubation with 1uM 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic acid (Bodipy-FL C16, Thermo Fisher) at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: BODIPY FL C16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Invitrogen D3821) was used to assess the ability of 3T3s to transport fatty acids into the cell from their surroundings ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Invitrogen) and 2-mercaptoethanol (Gibco) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Microbiology 2020Quote: ... or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16, Thermo Fisher Scientific) in a modified SC medium ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Immunology 2020Quote: For acid induced unfolding experiments the hydrophobic dye BIS-ANS (4,4’-dianilino1,1’-binaphthyl-5,5’-disulfonic acid, Invitrogen) was used to monitor protein unfolding by fluorescence spectroscopy with an excitation wavelength of 390 nm ...
-
bioRxiv - Biophysics 2020Quote: ... hexanoyl)-2-(4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphoethanolamine) (Invitrogen). Cleavage of PED-6 eliminates a self-quenching effect that results in the release of a BODIPY-FL dye ...
-
bioRxiv - Cell Biology 2021Quote: ... 10mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), 1% Penicillin/Streptomycin/L-Glutamate (P/S/G ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Plant Biology 2022Quote: ... pH 5.5 and 100 μM 3′,5′-dimethoxy-4′-hydroxyacetophenone (acetosyringone) (115540050; Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (D8418 ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Plant Biology 2021Quote: ... The supernatant was discarded and the pellet was resuspended in 5 mL liquid KNOP supplemented with 2% (w/v) sucrose (#S/8600/60, Fisher) and 100 μM 3’,5’-dimethoxy-4’-hydroxyacetophenone (acetosyringone) (#115540050, Acros Organics, dissolved in dimethyl sulfoxide (DMSO) (#D8418 ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... cells were stained by BODIPY™ FL C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific #D3922) to determine the amount of lipid droplet in regular conditions ...
-
bioRxiv - Genetics 2020Quote: ... 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene 3-dodecanoic acid (BODIPY™ FL C12; Thermo Fisher Scientific, USA) (4 µg/mL ...
-
bioRxiv - Molecular Biology 2023Quote: ... P8 pups were fed 1 μl 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid BODIPY™ FL C16 (BODIPY FL C16, ThermoFisher Scientific, D3821) diluted in olive oil at a concentration of 10 μg/μL ...
-
bioRxiv - Microbiology 2022Quote: 8-Hydroxyquinoline-2-carboxylic acid (98%, ACROS Organics) was dissolved in distilled water with pH adjusted to 10 using a solution of 1 M sodium hydroxide for better solubility ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Systems Biology 2021Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1× MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Microbiology 2020Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES, Gibco), and 1X MEM non-essential amino acids solution (Gibco) ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Cell Biology 2023Quote: ... 20 nM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco) and 50 µM 2-Mercaptoethanol (Gibco ...
-
bioRxiv - Biochemistry 2023Quote: ... 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Acros Organics, ThermoFisher), Magnetic nanobeads (Ocean Nanotech ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...