Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 cyclopropylpyridazin 3 amine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... siRNA was bound to siPORT Amine Transfection Reagent (Ambion) and added to culture cells (0.66 μg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% biotinylated dextran amine (BDA 10 kD; D1956, Invitrogen) in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... 10 % biotinylated dextran-amine (BDA; 10,000 MW, Molecular Probes), in the MSDB complex ...
-
bioRxiv - Pathology 2020Quote: ... and amine reactive fixable viability stain red (Life Technologies); all prepared in brilliant stain buffer (BD Biosciences) ...
-
bioRxiv - Cell Biology 2021Quote: ... ArC™ Amine Reactive Compensation Bead Kit (Thermofisher, A10346) were used for GhostDye™ Live/Dead stain ...
-
bioRxiv - Developmental Biology 2022Quote: ... Two units of amine reactive succinimidyl ester Decapacks (ThermoFisher) were used for each reaction and following quenching labeled probes were purified using Reverse-Phase HPLC ...
-
bioRxiv - Immunology 2022Quote: ... and Arc amine reactive compensation beads (Invitrogen, Cat# A10346) were used ...
-
bioRxiv - Immunology 2023Quote: ... ArC Amine Reactive Compensation Bead Kit (Thermo Fisher, A10346) were used for Zombie UVTM stain ...
-
bioRxiv - Microbiology 2023Quote: ... and ArC™ Amine Reactive Compensation Beads (Life Technologies) were used for all single-color controls ...
-
bioRxiv - Neuroscience 2023Quote: ... and ArC™ Amine Reactive Compensation Bead Kit (ThermoFisher) Samples were placed at 4°C until ready to be acquired by flow cytometry.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Biochemistry 2020Quote: ... Arrays were generated by printing purified proteins onto aminosilane coated slides with printing buffer containing an amine-to-amine homobifunctional crosslinker (bissulfosuccinimidyl suberate, BS3, Thermo Scientific Pierce(tm) Cat # A39266 ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cancer Biology 2021Quote: ... amine-based fixable live/dead solutions (Life Technologies, Cat. #L23101) were added to cell media of living LECs after 48 hours of drug treatment and five random images were taken of each well ...
-
bioRxiv - Neuroscience 2020Quote: ... An anterograde tracer of 5% biotinylated dextran amine (BDA; Invitrogen) was used in some cases ...
-
bioRxiv - Microbiology 2021Quote: Wells of amine-reactive maleic anhydride-derivatized plates (Thermo Scientific) were coated overnight with recombinant SARS-CoV-2 Receptor binding domain (SARS-CoV-2 S protein RBD ...
-
bioRxiv - Cell Biology 2021Quote: ... Yellow amine-reactive live/dead cell dye (Thermo Fisher, L34959) was used for live/dead discrimination ...
-
bioRxiv - Immunology 2020Quote: ... Aqua live/dead amine reactive dye (Life Technologies, Carlsbad, CA) was used for dead cell exclusion ...
-
bioRxiv - Neuroscience 2021Quote: ... or Fluoro-Ruby (tetramethylrhodamine) conjugated to dextran amine (FR; Invitrogen) (Table 1) ...
-
bioRxiv - Biophysics 2022Quote: ... we labeled Rubisco with amine-reactive Alexa 488 (Invitrogen, A10235) and removed free dyes using Micro BioSpin 30 chromatography column ...
-
bioRxiv - Immunology 2023Quote: ... Amine-reactive Alexa FluorTM 555 NHS ester (Thermo Fisher Scientific) was added to IgG samples to final concentrations of fluorochrome 40 μM and incubated for 1 hour at room temperature with constant gentle agitation ...
-
bioRxiv - Neuroscience 2023Quote: ... for antibodies or ArC Amine Reactive Compensation Beads (ThermoFisher, #A1034) for the LIVE/DEAD dye.
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... or 3.5% 10 kDa biotinylated dextran amine (BDA, Invitrogen, Molecular Probes) was injected iontophoretically with positive 6 μA current pulses (6 s on ...
-
bioRxiv - Neuroscience 2021Quote: ... or 3.5% 10 kDa biotinylated dextran amine (BDA, Invitrogen, Molecular Probes) was injected iontophoretically with positive 6 μA current pulses (6 s on ...
-
bioRxiv - Neuroscience 2021Quote: Biotin Dextran Amine (BDA, Thermo Fisher Scientific, Waltham, MA, USA, D1817) and fluorescent retrograde tracer cholera toxin B subunit conjugated to fluorophore Alexa 488 (CTB488 ...
-
bioRxiv - Neuroscience 2021Quote: ... A small crystal of tetramethylrhodamine dextran amines 3000 (Life technologies, NY) was placed for 15-20 min at the edge of the auditory nerve coming out at the internal auditory canal of the intact cochlea and rinsed with artificial perilymph ...
-
bioRxiv - Neuroscience 2022Quote: ... mixed with 5% biotinylated dextrane amine (BDA, MW: 10.000, Molecular Probes: D1956 ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: Myelin was labeled with amine reactive pHrodoTM Red succinimidyl ester (ThermoFisher) for 45 min at RT (protected from light) ...
-
bioRxiv - Neuroscience 2022Quote: ... or 3.5–5.0% 10 kDa biotinylated dextran amine (BDA; Invitrogen, #D1956) was injected iontophoretically with positive 6–12 mA current pulses (6 s on ...
-
bioRxiv - Cell Biology 2020Quote: ... and stained with Live Dead Blue amine dye (Thermo Fisher, L34961). A cocktail of antibodies was prepared fresh and supplemented with Monocyte Blocker (BioLegend ...
-
bioRxiv - Biophysics 2021Quote: Qdot 655 amine-derivatized polyethylene glycol (PEG) conjugates (4 µM; Invitrogen) were mixed with 50 mM Sulfo-SMCC (Thermo ...
-
bioRxiv - Immunology 2021Quote: ... and ArC Amine Reactive Compensation Beads (Cat. No. A10346, Life Technologies) were used for compensation ...
-
bioRxiv - Neuroscience 2021Quote: ... TMT10-plex amine reactive reagents (Thermo Fisher, 5 mg per vial) were re-suspended in 1024 μL anhydrous acetonitrile and 25 μL of reagent was added to each sample (TMT label ...
-
bioRxiv - Immunology 2023Quote: ... Alexa Fluor amine-reactive dye AF-488-TFP (Molecular probes / Invitrogen) was prepared by dissolving 1 mg in 100 μL of DMSO and used to label x-mAb according to manufacturer’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... Alexa Fluor amine-reactive dye AF-488-TFP (Molecular probes / Invitrogen) was prepared by dissolving 1 mg in 100 μL of DMSO and used to label x-mAb according to manufacturer’s instruction ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Genetics 2023Quote: 3 independent total RNA extractions from 30 ovaries from 3-6-day-old RevI-H2i2 flies using Trizol (Invitrogen) were performed ...
-
bioRxiv - Biochemistry 2019Quote: ... or DyLight Amine-Reactive Dyes (DyLight 488 NHS Ester, Thermo Fisher Scientific) according to the standard procedure ...
-
bioRxiv - Bioengineering 2020Quote: ... EZ-Link amine-PEG2-biotin and neutravidin protein was purchased from ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... we used 10,000 Da lysine-fixable biotinylated dextran-amine (BDA; Invitrogen, D1956), iontophoretically delivered into the appropriate cortical location ...
-
bioRxiv - Neuroscience 2021Quote: ... biotinylated dextran amine (molecular weight: 10,000, 10% in saline; Thermo Fisher Scientific) was injected into the Po (1.7 mm posterior to bregma and 1.3 mm lateral to the midline) ...