Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2023Quote: ... Treatments were incubated 2 hours before addition of the MTS (3-(4,5-Dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) reagent (Thermo-Fisher Scientific, Waltham, MA) and incubation was continued another 1.5 hours ...
-
bioRxiv - Immunology 2022Quote: ... 5 mM non-essential amino acids (Gibco), 5 mM HEPES (Gibco) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5% (v/v) acetic acid) (ThermoFisher, A40000279) to visualize the proteins run on the paper ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5% non-essential amino acids (Gibco). Cells were maintained at 37 °C in a 5% CO2 environment with saturated humidity.
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Bioengineering 2024Quote: ... 5 mL non-essential amino acids (Gibco), and 5 mL antibiotic-antimycotic (Gibco) ...
-
bioRxiv - Plant Biology 2024Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Microbiology 2020Quote: ... or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16, Thermo Fisher Scientific) in a modified SC medium ...
-
bioRxiv - Cell Biology 2023Quote: ... Proteins were resolved on precast NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). Samples were transferred to 0.45 µm nitrocellulose membrane (0.9 A ...
-
bioRxiv - Cell Biology 2022Quote: ... at 180V on precast either NuPAGE Novex 4-12% Bis-Tris Gels in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen), or NuPAGE™ 3-8% Tris-Acetate gels in NuPAGE™ Tris-Acetate SDS Running Buffer (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2024Quote: ... and 5’-TGCTGTTCTCTGTGACTCTGGATCTGGTTTTGGCCACTGACTGACCAGATCC AGTCACAGAGAA-3’ and 5’-CCTGTTCTCTGTGACTGGATCTGGTCAGTCAGTGGCCAAAACCAGATCCAGAGTCACAGAGAAC-3’ (KD2) were obtained from Invitrogen, annealed ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... All other lines were passaged at approximately 80% confluency (every 4-5 days on average) as tiny clusters (3-5 cells on average) using 0.5 mM EDTA (15575020, Gibco, concentration 10 mM).
-
bioRxiv - Developmental Biology 2023Quote: ... An internal standard was prepared from the isotope-labeled standards in 3% acetonitrile with 0.1% formic acid with 5 fmol/µL of Peptide Retention Time Calibration (PRTC) mixture (ThermoFisher Scientific) and 10 µg/mL E ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Developmental Biology 2020Quote: ... sections were rinsed in 3% acetic acid (Fisher Scientific) for 3 minutes and incubated at room temperature for 30 minutes in 1% Alcian Blue 8GX (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3-mercaptopropionic acid were purchased from ACROS ORGANICS. Hydrogen tetrachloroaurate(III ...
-
bioRxiv - Developmental Biology 2023Quote: ... acidified to pH2-3 by trifluoroacetic acid (Thermofisher, 85183), and desalted with a Pierce C18 spin column (Thermo Fisher Scientific ...
-
bioRxiv - Genomics 2021Quote: The metabolism of 4-hydroxyphenylacetic acid (p-hydroxyphenylacetic acid; Acros Organics, Product code: 121710250) and gentisic acid (2,5-dihydroxybenzoic acid ...
-
bioRxiv - Immunology 2021Quote: ... PBMCs were incubated for 20 min at 37°C in PBS containing 4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16; 1 μM; Thermo Fisher Scientific). To determine neutral lipid content ...
-
bioRxiv - Biophysics 2023Quote: ... 7-Diethylamino-3-(4’-Maleimidylphenyl)-4-Methylcoumarin (CPM) (Invitrogen. USA), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5% non-essential amino acids (NEAA, ThermoFisher Scientific), 1% 2-Mercaptoethanol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 400 mL acid phenol: chloroform 5: 1 (Ambion), and 50 mL 0.5 mm zirconia/silica beads (BioSpec) ...
-
bioRxiv - Immunology 2023Quote: ... and 5 g/L casamino acids (Gibco, 223120) in deionized water] ...
-
bioRxiv - Bioengineering 2022Quote: ... 5-norbornene-2-carboxylic acid (99%, Fisher Scientific) (12:1 to HA-TBA repeat unit) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5 ml MEM Non-Essential Amino Acids (Gibco), 5 ml Sodium pyruvate solution (100 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5% non-essential amino acids (NEAA, ThermoFisher). The BMK-dko cell line was a kind gift from the originator Eileen White ...
-
bioRxiv - Genomics 2024Quote: ... 350µL Acid Phenol:chloroform (5:1; ThermoFisher cat# AM9720), and 350µL NETS (300mM NaCl ...
-
bioRxiv - Genetics 2024Quote: ... 400 µL acid phenol: chloroform 5: 1 (Ambion) was added ...
-
bioRxiv - Plant Biology 2024Quote: ... was amplified by the primers (5’-CACCATATTAATGTTTCGATCATCAGAATC-3’ and 5’-TTCGATAGTGTTGGATTATATAGGG-3’) and cloned into the pENTR 5’-TOPO (Invitrogen) (51) ...
-
bioRxiv - Genetics 2021Quote: ... The membrane was hybridized with a biotin-conjugated telomere probe (5’-biotin-CACACCCACACCCACACC-3’) and was imaged using a Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific) and a Li-Cor C-DiGit Chemiluminescent Western Blot scanner.
-
bioRxiv - Cell Biology 2021Quote: ... the peptides were resuspended in 3% formic acid (FA)/5% acetonitrile (ACN) and loaded onto a nanoLC system (RSLCnano, Thermo Scientific). First ...
-
bioRxiv - Microbiology 2022Quote: ... Amino acids were extracted on ice-cold lysis buffer [5:3:2 ratio of methanol-acetonitrile-water (Fisher Scientific, Pittsburgh, PA)] containing 3 µM of amino acid standards [Cambridge Isotope Laboratories ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and (MtWOX5) 5’-CACCATGCAGACGGTCCGAGATCTGTC-3’ and 5’- CCTTCGCTTAAGTTTCATGTAA-3’ (AhWOX5) and cloned into pENTR-dTOPO (Invitrogen). The entry clones of AhWOX5 & MtWOX5 recombined through LR clonase Gateway technology (Invitrogen ...
-
bioRxiv - Cell Biology 2023Quote: ... Target mtDNA gene (Forward primer: 5′-CACCCAAGAACAGGGTTTGT-3′, Reverse primer: 5′-TGGCCATGGGTATGTTGTTAA-3′, Invitrogen custom primers) and reference 18S ribosomal RNA gene (Forward primer ...
-
bioRxiv - Microbiology 2024Quote: ... This was followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for about 10 min ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2022Quote: ... 5’-AAAGCTCGAGCTCTACAAATGTGGTATGGCTG-3’ (Thermo Fisher Scientific). PCR products were purified (Monarch PCR Cleanup Kit (NEB ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5’-UAGCGACUAAACACAUCAA-3’ (Thermo Fisher Scientific); RNF168 siRNA #1,siGENOME Smartpool Dharmacon (Cat# M-007152-03) ...
-
bioRxiv - Physiology 2020Quote: ... 5’-UUGAUUUGCUGAGAAGGAC-3’ (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2024Quote: ... 5-(3-aminoallyl)-dUTP (Invitrogen, AM8439); BSPEG9 (thermofisher ...
-
ISL2 is an epigenetically silenced tumor suppressor and regulator of metabolism in pancreatic cancerbioRxiv - Molecular Biology 2020Quote: ... cells were stained by BODIPY™ FL C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific #D3922) to determine the amount of lipid droplet in regular conditions ...