Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 3 4 Fluorophenyl 5 fluorobenzoic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNA#4: 5’-AUAGCGUUUCUUCUAACUGGGCAGC-3’ (Invitrogen). siRNAs #2 and #4 significantly decreased the mRNA levels to the greatest extent and both had the same mitotic phenotypes ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Neuroscience 2024Quote: ... BODIPYTM-C12 500/510-C1 (4,4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid; Invitrogen) or BODIPYTM-C12 558/568 (4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid ...
-
bioRxiv - Molecular Biology 2022Quote: ... siM1-4: 5’ -ACTGGTAGCTTATTAAAGATT- 3’) and the HOXA1 siRNA (5’ - AGAACTTCAGTGCGCCTTATT- 3’) were purchased from Invitrogen™ (Silencer® Select siRNA ...
-
bioRxiv - Cell Biology 2024Quote: ... or BODIPY 558/568 C12 (C12) (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (ThermoFisher, #D3835) were complexed with fatty acid-free bovine serum albumin (BSA ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Neuroscience 2021Quote: ... and 2-(4-Iodophenyl)-3-(4-nitrophenyl)-5-phenyltetrazolium Chloride (INT, #I00671G, Fisher Scientific).
-
bioRxiv - Cell Biology 2020Quote: ... or BODIPY™ 558/568 C12 (4,4-Difluoro-5-(2-Thienyl)-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2024Quote: ... 3-4 or 5-6 and Phusion DNA polymerase (Thermo Fisher Scientific). The resulting PCR mix was DpnI digested and 4 μl of the mix was used for transformation of E ...
-
bioRxiv - Physiology 2022Quote: ... The samples were then mixed with 1 mL of a 3:13 solution of Ehrlich’s reagent (1.5 g of 4-[dimethylamino] benzaldehyde [ThermoFisher]; 5 mL ethanol; 337 µL sulfuric acid) to isopropanol and incubated for 30 min at 58°C ...
-
bioRxiv - Cell Biology 2021Quote: ... were separated using NuPAGE Bis-Tris gels (4 – 12 %) with 3-(N-morpholino)propanesulfonic acid (MOPS) or 2-(N-morpholino)ethanesulfonic acid (MES) running buffer (Thermo Fisher Scientific) followed by transferring to polyvinylidene difluoride (PVDF ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cell Biology 2024Quote: ... experiments were grown overnight in SDC at RT and then diluted in SDC and grown at 30°C for >4 h before being treated with either 500 µM 3-indole acetic acid (3-IAA; AID) for 1h or 1 µM estradiol + 1 µM 5-phenyl-IAA (5-Ph-IAA; Fisher Scientific) for 2h (grAID ...
-
bioRxiv - Plant Biology 2020Quote: ... 5-fluoroorotic acid (Fisher Scientific), adenosine-5′-monophosphate disodium (Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% nonessential amino acids (Gibco), and 10% FBS (Gibco ...
-
bioRxiv - Neuroscience 2020Quote: ... on a 4-12% bis-tris gel (Genescript) in 3-(N-morpholino)propanesulfonic acid (MOPS) buffer (Invitrogen). The gel was then fixed for 30 min in 10% acetic acid/50% methanol ...
-
bioRxiv - Cell Biology 2021Quote: ... For live imaging of cells as described for fatty acids up-take we treated cells at day 5 of differentiation with BODIPY™ (10μM) C12 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen). In addition ...
-
bioRxiv - Bioengineering 2023Quote: ... 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium (WST-8) was purchased from ThermoFisher Scientific.
-
bioRxiv - Immunology 2022Quote: ... resuspended in pre-sort buffer containing 3-5 nM SYTOX Green Nucleic Acid Stain (Thermo Fisher Scientific), and incubated for 20 min at 4°C ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2024Quote: ... and valproic acid (3 mM, Acros Organics). The DNA/FectoPro amount was scaled proportionally depending on the size of the transfection ...
-
bioRxiv - Bioengineering 2020Quote: ... Bodipy FL c16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Thermofisher) was diluted in sterile RPMI-1640 (Corning ...
-
bioRxiv - Immunology 2024Quote: 50 000 enriched CD11b+ LCs were seeded and incubated for 10min at 37°C with 2mM Bodipy-C11 (581/591) (4,4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-undecanoic acid; Invitrogen) in PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... the oligonucleotides 5’-CCTGTGCAGCCGTCCATAGGGCCTGTCAGTCAGTGGCCAAAACAGGCCTAT GAGGACGGCTGCAC-3’ and 5’-TGCTGTGCAGCCGTCCTCATAGGCCTGTTTTGGCCACTGACTGACAGGCCTATGGACGGCTGCA-3’ (#Mmi520981, Invitrogen) were used ...
-
bioRxiv - Bioengineering 2021Quote: ... 5 μg/mL ascorbic acid (Gibco), and 2.16 g/mL β-glycerolphosphate (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... in 5% acetic acid (Thermo Fisher) to ensure uniform loading ...
-
Potassium channel-driven bioelectric signaling regulates metastasis in triple-negative breast cancerbioRxiv - Cancer Biology 2021Quote: ... CDH11 #4: 5’-CCUUAUGACUCCAUUCAAA-3’ using Lipofectamine RNAiMAX transfection reagent (13778030; ThermoFisher Scientific, Waltham, MA) in serum-free DMEM ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Immunology 2021Quote: ... Uptake of fatty acids was quantified after incubation with 1uM 4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic acid (Bodipy-FL C16, Thermo Fisher) at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: BODIPY FL C16 (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid, Invitrogen D3821) was used to assess the ability of 3T3s to transport fatty acids into the cell from their surroundings ...
-
bioRxiv - Cell Biology 2024Quote: BODIPY-FL-C16 (C16) (4,4-Difluoro-5,7-Dimethyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Hexadecanoic Acid (ThermoFisher, #D3821) or BODIPY 558/568 C12 (C12 ...
-
bioRxiv - Biochemistry 2020Quote: Acetic Acid (Fisher Scientific, Cat. # 351269-4)
-
bioRxiv - Biochemistry 2021Quote: Acetic Acid (Fisher Scientific, Cat. # 351269-4)
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... indole-3-acetatic acid (Fisher Scientific, Catalog #11453194), tryptamine (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).